AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i202_exonuclease_sbcc_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 sbcD 189 ATP-dependent dsDNA exonuclease Motif number 1 GGTTGCGATCATTAATGCGACGTCATTATGC 1 34 1 ATTATGCGAC 0.990251 -156 TAAATCTGTCATAAATCTGACGCATAATGAC 1 55 0 ATAATCTGAC 0.979468 -135 CGAGCTTTTCATAAATCTGTCATAAATCTGA 1 66 0 ATAATCTGTC 0.9497 -124 TAACCTGAAGATATGTGCGACGAGCTTTTCA 1 86 0 ATATTGCGAC 0.992073 -104 CCATTTGCTTTTTTCTGCGCCACGGAAATCA 1 118 0 TTTTTGCGCC 0.946731 -72 TTATACCCAAACAGATGTGCCATTTGCTTTT 1 137 0 ACAGTGTGCC 0.961001 -53 CTGTTTGGGTATAATCGCGCCCATGCTTTTT 1 154 1 ATAACGCGCC 0.991226 -36 **** ****** Masking position 9 Map Score: 6.94532 Number of sites scoring better than the average of aligned sites = 1014 Number in coding regions = 928 Number in noncoding regions = 86 Number of orfs with sites within 600 bp upstream = 99 Fraction of orfs with sites within 600 bp upstream = 0.0159011 Motif number 2 TAATGACGTCGCATTAATGATCGCAACCTA 1 32 0 GCATTAATGA 0.753069 -158 ATTATGCGTCAGATTTATGACAGATTTATG 1 58 1 AGATTTATGA 0.992672 -132 GATTTATGACAGATTTATGAAAAGCTCGTC 1 69 1 AGATTTATGA 0.992672 -121 ACATATCTTCAGGTTATTGATTTCCGTGGC 1 101 1 AGGTTATTGA 0.974659 -89 ********** Masking position 5 Map Score: 3.98652 Number of sites scoring better than the average of aligned sites = 129 Number in coding regions = 105 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 CTGTTGTAATAAATAGGTTGCGATCATTAA 1 19 1 AAATAGGTTG 0.951872 -171 ACAGATTTATGAAAAGCTCGTCGCACATAT 1 77 1 GAAAAGCTCG 0.985088 -113 GTGGCGCAGAAAAAAGCAAATGGCACATCT 1 126 1 AAAAAGCAAA 0.950314 -64 TTCCCTGGCGAAAAAGCATGGGCGCGATTA 1 165 0 AAAAAGCATG 0.992592 -25 ********** Masking position 5 Map Score: 0.439633 Number of sites scoring better than the average of aligned sites = 375 Number in coding regions = 297 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 79 Fraction of orfs with sites within 600 bp upstream = 0.0126887 Motif number 4 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.24418e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0