AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i209_rpod_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 dnaG 110 DNA biosynthesis; DNA primase #2 rpoD 194 RNA polymerase, sigma(70) factor; regulation of proteins induced at high temperatures #3 HI0532 133 DNA primase (dnaG) #4 HI0533 69 RNA polymerase sigma-70 factor (rpoD) Motif number 1 TGTAGTTGTAAGGCCGTGCTTCCGAAAGGA 1 46 1 AGGCCGTGCT 0.988361 -65 AAACGAAAATAAGCCGCGCATTCCTTTCGG 1 67 0 AAGCCGCGCA 0.991906 -44 AGGCCCCGATTTTTAGCAAT 1 101 0 AGGCCCCGAT 0.908872 -10 TTCGGCACTTAAGCCGTTAAA 2 2 0 AAGCCGTTAA 0.948886 -193 AAGCCCCCGACAGCCGCACTGAGAGGCAGC 2 43 1 CAGCCGCACT 0.983141 -152 CACTGAGAGGCAGCGGCAAATATATAAGTA 2 59 1 CAGCGGCAAA 0.835432 -136 GATAATTACGAGGGCGTACTTATATATTTG 2 75 0 AGGGCGTACT 0.833922 -120 CGATGTCCTTCAGCCGTTAACGCTGAAATC 2 126 0 CAGCCGTTAA 0.945538 -69 GAGTTAAGACAAACCGTGAATCCTTTGGAC 3 31 1 AAACCGTGAA 0.943999 -103 TAAAGTAACAAAACCGTGAGTCCAAAGGAT 3 50 0 AAACCGTGAG 0.860405 -84 ACGCCAAAAACGACCGCACTTTCACACCAC 3 96 1 CGACCGCACT 0.930047 -38 ********** Masking position 5 Map Score: 10.6346 Number of sites scoring better than the average of aligned sites = 4634 Number in coding regions = 4376 Number in noncoding regions = 258 Number of orfs with sites within 600 bp upstream = 255 Fraction of orfs with sites within 600 bp upstream = 0.0409573 Motif number 2 GGAGAGCAACGCTCTCGGGGAA 1 3 0 GCTCTCGGGG 0.997295 -108 CGAGAGCGTTGCTCTCCGATCAGACCGAGT 1 16 1 GCTCTCCGAT 0.952154 -95 CTTCCCGATCGCTCTTCGGCACTTAAGCCG 2 16 0 GCTCTTCGGC 0.956587 -179 TCTCAGTGCGGCTGTCGGGGGCTTCCCGAT 2 37 0 GCTGTCGGGG 0.996564 -158 AGCGTTAACGGCTGAAGGACATCGGGTCAA 2 132 1 GCTGAAGGAC 0.92036 -63 TCATGAGGTTGGTGTTGGGCGATTGACCCG 2 154 0 GGTGTTGGGC 0.957373 -41 TTCACACCACGATCACGGAGGCTCGACA 3 116 1 GATCACGGAG 0.926532 -18 ********** Masking position 3 Map Score: 6.28137 Number of sites scoring better than the average of aligned sites = 942 Number in coding regions = 895 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 3 AATGCGCGGCTTATTTTCGTTTATGAATTGCTAAAA 1 75 1 TTTTCGATGA 0.850339 -36 TATCCACACTTATTTCATGAGGTTGGTGTTGGGCGA 2 162 0 TTTATGTTGG 0.976741 -33 TTGGCGTAGATTTTTGTTGTGCTTAAAGTAACAAAA 3 67 0 TTTTTGTTAA 0.946689 -67 GAAAGTGCGGTCGTTTTTGGCGTAGATTTTTGTTGT 3 83 0 TTTTTGTAGA 0.965906 -51 GAAGATAAGATTTTTTATGAACTTGAGATTCTACCA 4 14 0 TTTATGTTGA 0.991339 -56 ATACTCGTTTTGCTTGATGTGATTGAGAAGATAAGA 4 40 0 TTTATGTTGA 0.991335 -30 * ** *** **** Masking position 5 Map Score: 0.817274 Number of sites scoring better than the average of aligned sites = 190 Number in coding regions = 162 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 32 Fraction of orfs with sites within 600 bp upstream = 0.00513974 Motif number 4 TCGGTCTGATCGGAGAGCAACGCTCTCGGGGA 1 12 0 CGGGACAACG 0.964893 -99 GAAGAGCGATCGGGAAGCCCCCGACAGCCGCA 2 29 1 CGGAACCCCC 0.992881 -166 TTATCGTTGGCGGTAAACAACCGTTGGATTTC 2 100 1 CGGAACAACC 0.99607 -95 GCCGTTAACGCTGAAATCCAACGGTTGTTTAC 2 112 0 CTGAACCAAC 0.965044 -83 AAGACGGTATCCACACTTATTTCATG 2 179 0 CGGATCACAC 0.976934 -16 *** ** ***** Masking position 8 Map Score: 1.07823 Number of sites scoring better than the average of aligned sites = 468 Number in coding regions = 436 Number in noncoding regions = 32 Number of orfs with sites within 600 bp upstream = 35 Fraction of orfs with sites within 600 bp upstream = 0.00562159 Motif number 5 ********** No masking Map Score: 4.64285e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.64285e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.64285e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0