AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i291_hish_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 HI1647 300 conserved hypothetical protein #2 HI1648 51 conserved hypothetical protein Motif number 1 TTTTAAAAACCTTTTTCTATGTGGTTAGAT 1 19 0 CTTTTTCTAT 0.969896 -282 TAGAAAAAGGTTTTTAAAAACATTTCAAGG 1 30 1 TTTTTAAAAA 0.464601 -271 TTTCAAGGTTTTTTTAATAACTATTGTGGC 1 52 1 TTTTTAATAA 0.714224 -249 AAAGTAGCTCTTTTTTCTATTATTAAATTG 1 107 1 TTTTTTCTAT 0.97827 -194 TTAATTTCAGTTTTTTGTATAAACGAAGTG 1 158 0 TTTTTTGTAT 0.97178 -143 GACATTATGCCTTTTAATATATACACATTT 1 196 1 CTTTTAATAT 0.875167 -105 TATATACACATTTTTTCAAACTTGTTCTAA 1 213 1 TTTTTTCAAA 0.909114 -88 TTTTTTCAAACTTGTTCTAAAGACTTTTCT 1 223 1 CTTGTTCTAA 0.882466 -78 AGCTACGTTTTTTATTGTAATGTAGAAAAG 1 246 0 TTTATTGTAA 0.844493 -55 CATTATTTGATTATTTGTATTGATAGCTAC 1 270 0 TTATTTGTAT 0.828963 -31 ********** Masking position 5 Map Score: 10.646 Number of sites scoring better than the average of aligned sites = 408 Number in coding regions = 234 Number in noncoding regions = 174 Number of orfs with sites within 600 bp upstream = 181 Fraction of orfs with sites within 600 bp upstream = 0.0290716 Motif number 2 TTCGTCCTTAAGTGCCACAATAGTTATTAAA 1 64 0 AGTGCCACAT 0.977483 -237 AATAGAAAAAAGAGCTACTTTAGCTGAAAGA 1 97 0 AGAGCTACTT 0.99023 -204 GTATATATTAAAAGGCATAATGTCTAGCGTG 1 189 0 AAAGGCATAT 0.887216 -112 ATTTGTATTGATAGCTACGTTTTTTATTGTA 1 257 0 ATAGCTACTT 0.965327 -44 GGCACCTTGTAGAGCTAATATTCCGATTTTC 2 13 0 AGAGCTAAAT 0.955686 -39 CATGTTCCGCAAAGGCACCTTGTAGAGCTAA 2 26 0 AAAGGCACTT 0.975636 -26 ******** ** Masking position 7 Map Score: 2.39937 Number of sites scoring better than the average of aligned sites = 364 Number in coding regions = 327 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 3 AACTATTGTGGCACTTAAGGACGAAATTCTTTC 1 70 1 GATTAAGACG 0.994723 -231 TTGTATAAACGAAGTGTAGAACGTCAGAAGGAT 1 141 0 GATGTAGACG 0.996582 -160 ACAAAAAACTGAAATTAAGCACGCTAGACATTA 1 170 1 GATTAAGACG 0.994723 -131 GTTTTTTATTGTAATGTAGAAAAGTCTTTAGAA 1 237 0 GATGTAGAAA 0.948644 -64 * * ***** *** Masking position 8 Map Score: 0.710772 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 31 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 CACATAGAAAAAGGTTTTTAAAAACATTTC 1 26 1 AAGGTTTTTA 0.933882 -275 AAGGTTTTTAAAAACATTTCAAGGTTTTTT 1 36 1 AAAACATTTC 0.86991 -265 AAAACATTTCAAGGTTTTTTTAATAACTAT 1 46 1 AAGGTTTTTT 0.931688 -255 ACTTTAGCTGAAAGAATTTCGTCCTTAAGT 1 82 0 AAAGAATTTC 0.926829 -219 AGAACGTCAGAAGGATTGTCCAATTTAATA 1 127 0 AAGGATTGTC 0.964258 -174 ACTTGTTCTAAAGACTTTTCTACATTACAA 1 232 1 AAGACTTTTC 0.974421 -69 ********** Masking position 7 Map Score: 2.1243 Number of sites scoring better than the average of aligned sites = 602 Number in coding regions = 489 Number in noncoding regions = 113 Number of orfs with sites within 600 bp upstream = 133 Fraction of orfs with sites within 600 bp upstream = 0.021362 Motif number 5 ********** No masking Map Score: 4.78496e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.78496e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 4.78496e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0