AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i338_weak1_ecoli_hinf_reg_100.orf -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.46 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.46 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 bioB 86 biotin synthesis, sulfur insertion? #2 HI1556 59 2-hydroxyacid dehydrogenase #3 HI1560 22 H. influenzae predicted coding region HI1560 #4 HI1561 106 peptide chain release factor 1 (prfA) Motif number 1 AATCTTTTCAATTTGGTTTACAAGTCGATT 1 11 0 ATTTGGTTTA 0.926408 -76 ATTGAAAAGATTTAGGTTTACAAGTCTACA 1 29 1 TTTAGGTTTA 0.912673 -58 TTTGTTGTTAATTCGGTGTAGACTTGTAAA 1 45 0 ATTCGGTGTA 0.979836 -42 AAAAAACACGTTTTGGAGAAGCCCC 1 72 1 TTTTGGAGAA 0.904777 -15 TTAACCGCACTTTTGATGAAAT 2 3 0 TTTTGATGAA 0.930073 -57 TTCATCAAAAGTGCGGTTAATTTTGACCGC 2 13 1 GTGCGGTTAA 0.964579 -47 TATATACAAAGTGCGGTCAAAATTAACCGC 2 25 0 GTGCGGTCAA 0.924509 -35 GACGCTTTATTTGTGATTTACCCA 4 5 0 TTGTGATTTA 0.828209 -102 TTAATTTCCTTTTCGCTGTCAATTTTCCCT 4 43 1 TTTCGCTGTC 0.904268 -64 CCGATTTTATTTTCGGTGACTTACAA 4 91 1 TTTCGGTGAC 0.982779 -16 ********** Masking position 2 Map Score: 9.47251 Number of sites scoring better than the average of aligned sites = 2308 Number in coding regions = 2083 Number in noncoding regions = 225 Number of orfs with sites within 600 bp upstream = 261 Fraction of orfs with sites within 600 bp upstream = 0.041921 Motif number 2 CACTTTGTATATAAAAAAGGAGCAATTA 2 42 1 ATAAAAAAGG 0.940207 -18 CTGAAATCAGATGTCCCTAT 3 13 0 CTGAAATCAG 0.886114 -10 TCAATTTTCCCTAAAATCGGCTAGAATACG 4 61 1 CTAAAATCGG 0.995856 -46 CTAAAATCGGCTAGAATACGCCGATTTTAT 4 71 1 CTAGAATACG 0.951425 -36 GTCACCGAAAATAAAATCGGCGTATTCTAG 4 81 0 ATAAAATCGG 0.991481 -26 ********** Masking position 5 Map Score: 4.32478 Number of sites scoring better than the average of aligned sites = 222 Number in coding regions = 202 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 3 AATCGACTTGTAAACCAAATTGAAAAG 1 8 1 TTGTAAACCA 0.819397 -79 CGGTGTAGACTTGTAAACCTAAATCTTTTC 1 32 0 TTGTAAACCT 0.963331 -55 TGACCGCACTTTGTATATAAAAAAGGAGCA 2 36 1 TTGTATATAA 0.71468 -24 TGGGTAAATCACAAATAAAGC 4 2 1 GGGTAAATCA 0.967313 -105 TTGTAAGTCACCGAAAATAA 4 97 0 TTGTAAGTCA 0.986112 -10 ********** Masking position 5 Map Score: 4.17446 Number of sites scoring better than the average of aligned sites = 117 Number in coding regions = 92 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 4 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0