AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_ecoli_mtub_100.orf -o118_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 queA 92 synthesis of queuine in tRNA; probably S-adenosylmethionine:tRNA ribosyltransferase-isomerase #2 tgt 55 tRNA-guanine transglycosylase #3 yajC 22 orf, hypothetical protein #4 secD 27 protein secretion; membrane protein, part of the channel #5 secD 109 secD Motif number 1 CCGGGGCGCTCTCCCTGCAACCTTTACCCC 1 32 0 CTCCCTGCAA 0.959261 -61 GCAGGGAGAGCGCCCCGGCACTAGACTACC 1 44 1 CGCCCCGGCA 0.58084 -49 CGGCACTAGACTACCCGCCTCTTATTTTAG 1 59 1 CTACCCGCCT 0.971684 -34 TTTAAACCAGCGCCGCGGAA 2 1 0 CGCCGCGGAA 0.548343 -55 CCGGCAACCGGCCGACCGGAACCG 5 5 1 CAACCGGCCG 0.914032 -105 CGACCGGAACCGACGAGCCGCTTGCGCGAC 5 23 1 CGACGAGCCG 0.811783 -87 CGCCGGGGCGCGTCGCGCAAGCGGCTCGTC 5 34 0 CGTCGCGCAA 0.960843 -76 TTGCGCGACGCGCCCCGGCGCGACACGTAG 5 44 1 CGCCCCGGCG 0.501634 -66 CCGACAGAGCCTACGTGTCGCGCCGGGGCG 5 54 0 CTACGTGTCG 0.590028 -56 ********** Masking position 4 Map Score: 14.7855 Number of sites scoring better than the average of aligned sites = 4002 Number in coding regions = 3803 Number in noncoding regions = 199 Number of orfs with sites within 600 bp upstream = 184 Fraction of orfs with sites within 600 bp upstream = 0.0295535 Motif number 2 TTACCCCCTTTTGGATAGAATATAATCG 1 9 0 TTGGATAGAA 0.889731 -84 CTATCCAAAAGGGGGTAAAGGTTGCAGGGA 1 21 1 GGGGGTAAAG 0.98383 -72 GGTAAAGGTTGCAGGGAGAGCGCCCCGGCA 1 34 1 GCAGGGAGAG 0.954268 -59 TTCTGACGTAGTGGAGAAAAA 2 45 1 GTGGAGAAAA 0.964465 -11 TATTAATAATGAGGGAAATTTA 3 10 1 TGAGGGAAAT 0.897109 -13 GGCAATTCCCTTAGGGAAAAATTTTAA 4 8 0 TTAGGGAAAA 0.944787 -20 AGGCTCTGTCGGGGGTAGAAAACTGATTCT 5 72 1 GGGGGTAGAA 0.990924 -38 TGATTCTCGAGGAGATACAAGGAAC 5 95 1 GGAGATACAA 0.909399 -15 ********** Masking position 7 Map Score: 6.64286 Number of sites scoring better than the average of aligned sites = 1519 Number in coding regions = 1224 Number in noncoding regions = 295 Number of orfs with sites within 600 bp upstream = 254 Fraction of orfs with sites within 600 bp upstream = 0.0407967 Motif number 3 GAGGCGGGTAGTCTAGTGCCGGGGCGCTCTCC 1 48 0 GTTAGGCCGG 0.986047 -45 CTCTTATTTTAGTCTGAGTCAGTGTC 1 77 1 AGCTGGTCAG 0.959805 -16 GCGGCTCGTCGGTTCCGGTCGGCCGGTTGCCG 5 12 0 GGTCCGTCGG 0.996392 -98 CAGAGCCTACGTGTCGCGCCGGGGCGCGTCGC 5 48 0 GTTCGGCCGG 0.994752 -62 CGCGACACGTAGGCTCTGTCGGGGGTAGAAAA 5 62 1 AGCTCGTCGG 0.988446 -48 ** *** ***** Masking position 8 Map Score: 0.604643 Number of sites scoring better than the average of aligned sites = 756 Number in coding regions = 718 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0