AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_ecoli_mtub_300.orf -o118_ecoli_mtub_300.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 queA 92 synthesis of queuine in tRNA; probably S-adenosylmethionine:tRNA ribosyltransferase-isomerase #2 tgt 55 tRNA-guanine transglycosylase #3 yajC 22 orf, hypothetical protein #4 secD 27 protein secretion; membrane protein, part of the channel #5 secD 109 secD #6 Rv2588c 166 hypothetical protein Rv2588c Motif number 1 GTAGTCTAGTGCCGGGGCGCTCTCCCTGCA 1 43 0 GCCGGGGCGC 0.993708 -50 TAAAATAAGAGGCGGGTAGTCTAGTGCCGG 1 58 0 GGCGGGTAGT 0.921374 -35 TTCCGCGGCGCTGGTTTAAAA 2 2 1 TCCGCGGCGC 0.915227 -54 CGTCGGTTCCGGTCGGCCGGTTGCCGG 5 8 0 GGTCGGCCGG 0.988251 -102 TCGCGCAAGCGGCTCGTCGGTTCCGGTCGG 5 22 0 GGCTCGTCGG 0.992043 -88 GTCGCGCCGGGGCGCGTCGCGCAAGCGGCT 5 38 0 GGCGCGTCGC 0.996953 -72 GAGCCTACGTGTCGCGCCGGGGCGCGTCGC 5 48 0 GTCGCGCCGG 0.993907 -62 CGGCGAGCCGGGTGAGGAGGATCT 6 5 0 GGTGAGGAGG 0.825288 -162 CTCCTCACCCGGCTCGCCGGTTCACATCGC 6 16 1 GGCTCGCCGG 0.997372 -151 CGTCCAGTCTGGCAGGCCGGAAACATCGGT 6 65 0 GGCAGGCCGG 0.9978 -102 CAGGCCTACCCGCGGGCCGCGCACCTGGTA 6 110 0 CGCGGGCCGC 0.993618 -57 GCGGCCCGCGGGTAGGCCTGGCACCGTGAT 6 120 1 GGTAGGCCTG 0.877866 -47 ********** Masking position 6 Map Score: 23.9134 Number of sites scoring better than the average of aligned sites = 3763 Number in coding regions = 3623 Number in noncoding regions = 140 Number of orfs with sites within 600 bp upstream = 135 Fraction of orfs with sites within 600 bp upstream = 0.0216833 Motif number 2 AGTGCCGGGGCGCTCTCCCTGCAACCTTTAC 1 35 0 CGCTCTCCTG 0.867696 -58 GGAGAGCGCCCCGGCACTAGACTACCCGCCT 1 48 1 CCGGCACTGA 0.867213 -45 TTCCGCGGCGCTGGTTTAAAACGT 2 4 1 CGCGGCGCGG 0.892696 -52 CCGGCAACCGGCCGACCGGAA 5 1 1 CCGGCAACGG 0.752579 -109 CGGGGCGCGTCGCGCAAGCGGCTCGTCGGTT 5 30 0 CGCGCAAGGG 0.979557 -80 GCTTGCGCGACGCGCCCCGGCGCGACACGTA 5 42 1 CGCGCCCCGC 0.978153 -68 AGATCCTCCTCACCCGGCTCGCCGGTT 6 7 1 TCCTCACCGG 0.838058 -160 CCGGAAACATCGGTCAGCAGATAGGCTTTAC 6 48 0 CGGTCAGCGA 0.935596 -119 CCCGTCCAGTCTGGCAGGCCGGAAACATCGG 6 66 0 CTGGCAGGCG 0.74704 -101 CCAGACTGGACGGGCACACTGGACTGTTACC 6 83 1 CGGGCACATG 0.95429 -84 ACCCGCGGGCCGCGCACCTGGTAACAGTCCA 6 102 0 CGCGCACCGG 0.986493 -65 GCGGGTAGGCCTGGCACCGTGATCGCAATAC 6 127 1 CTGGCACCTG 0.97556 -40 ******** ** Masking position 1 Map Score: 12.1068 Number of sites scoring better than the average of aligned sites = 5913 Number in coding regions = 5660 Number in noncoding regions = 253 Number of orfs with sites within 600 bp upstream = 216 Fraction of orfs with sites within 600 bp upstream = 0.0346932 Motif number 3 GTGCCGGGGCGCTCTCCCTGCAACCTTTAC 1 35 0 GCTCTCCCTG 0.972771 -58 CCGGCAACCGGCCGACCGGAA 5 2 1 CGGCAACCGG 0.979374 -108 GGGGCGCGTCGCGCAAGCGGCTCGTCGGTT 5 30 0 GCGCAAGCGG 0.938962 -80 AGATCCTCCTCACCCGGCTCGCCGGTT 6 8 1 CCTCACCCGG 0.991926 -159 CAGACTGGACGGGCACACTGGACTGTTACC 6 84 1 GGGCACACTG 0.977234 -83 CCCGCGGGCCGCGCACCTGGTAACAGTCCA 6 102 0 GCGCACCTGG 0.993054 -65 TATTGGTATTGCGATCACGGTGCCAGGCCT 6 133 0 GCGATCACGG 0.954372 -34 ********** Masking position 10 Map Score: 9.10029 Number of sites scoring better than the average of aligned sites = 2224 Number in coding regions = 1937 Number in noncoding regions = 287 Number of orfs with sites within 600 bp upstream = 165 Fraction of orfs with sites within 600 bp upstream = 0.0265018 Motif number 4 TTCTATCCAAAAGGGGGTAAAGGTTGCAGG 1 19 1 AAGGGGGTAA 0.973029 -74 CTAAAATAAGAGGCGGGTAGTCTAGTGCCG 1 59 0 AGGCGGGTAG 0.989157 -34 GTAGGCTCTGTCGGGGGTAGAAAACTGATT 5 70 1 TCGGGGGTAG 0.992237 -40 CCGGTTCACATCGCTGGTAAAGCCTATCTG 6 32 1 TCGCTGGTAA 0.981325 -135 GCGGGCCGCGCACCTGGTAACAGTCCAGTG 6 99 0 CACCTGGTAA 0.892146 -68 GGTGCGCGGCCCGCGGGTAGGCCTGGCACC 6 115 1 CCGCGGGTAG 0.997361 -52 ********** Masking position 8 Map Score: 6.39041 Number of sites scoring better than the average of aligned sites = 668 Number in coding regions = 638 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 5 ********** No masking Map Score: -2.24942e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 CGATTATATTCTATCCAAAAGGGGGTAAAGGT 1 9 1 TTCTCCAAGG 0.993048 -84 TGGACTGTTTTTCTGACGTAGTGGAGAAAAA 2 35 1 TTCTCGTAGG 0.997236 -21 TTAAAATTTTTCCCTAAGGGAATTGCC 4 7 1 TTTTCCTAGG 0.989094 -21 CAACCCGTCTTTCGTATTGGTATTGCGATC 6 147 0 GTCTCGTAGG 0.995292 -20 **** **** ** Masking position 10 Map Score: 0.27219 Number of sites scoring better than the average of aligned sites = 20 Number in coding regions = 17 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 7 ********** No masking Map Score: -2.24942e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.24942e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -2.24942e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0