AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i130_ecoli_mtub_100.orf -o130_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 Rv3779 89 hypothetical protein Rv3779 Motif number 1 GCCAGCCACCTTAGAACTCGG 1 2 1 CCAGCCACCT 0.996226 -88 CTGGGACGTCTAGGACACCCGAGTTCTAAG 1 20 0 TAGGACACCC 0.98517 -70 CCTAGACGTCCCAGCCCGCCCGGGCTTCCC 1 36 1 CCAGCCCGCC 0.998895 -54 TGACATGGCTCAGGGAAGCCCGGGCGGGCT 1 48 0 CAGGGAAGCC 0.993077 -42 GCCATGTCACCCGGCCAGCCATACTAATCG 1 69 1 CCGGCCAGCC 0.999779 -21 ********** Masking position 4 Map Score: 10.7613 Number of sites scoring better than the average of aligned sites = 1437 Number in coding regions = 1373 Number in noncoding regions = 64 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 2 CTAGGACACCCGAGTTCTAAGGTGGCTGGC 1 9 0 CGAGTTAAGG 0.996363 -81 CAGGGAAGCCCGGGCGGGCTGGGACGTCTAGG 1 36 0 CGGGCGCTGG 0.957415 -54 TATGGCTGGCCGGGTGACATGGCTCAGGGAAG 1 60 0 CGGGTCATGG 0.998734 -30 TCGATTAGTATGGCTGGCCGGGT 1 77 0 CGATTTATGG 0.989935 -13 ***** ***** Masking position 2 Map Score: 3.6567 Number of sites scoring better than the average of aligned sites = 179 Number in coding regions = 174 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 GCCAGCCACCTTAGAACTCGGGT 1 4 1 AGCCACCTTA 0.994977 -86 GGGACGTCTAGGACACCCGAGTTCTAAGGT 1 18 0 GGACACCCGA 0.986868 -72 CGGGTGTCCTAGACGTCCCAGCCCGCCCGG 1 29 1 AGACGTCCCA 0.991225 -61 GGCTTCCCTGAGCCATGTCACCCGGCCAGC 1 58 1 AGCCATGTCA 0.965689 -32 TCACCCGGCCAGCCATACTAATCGA 1 75 1 AGCCATACTA 0.990507 -15 ********** Masking position 10 Map Score: 6.17498 Number of sites scoring better than the average of aligned sites = 641 Number in coding regions = 592 Number in noncoding regions = 49 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 4 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.67335e-15 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0