AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i135_ecoli_mtub_100.orf -o135_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 tolB 132 periplasmic protein involved in the tonb-independent uptake of group A colicins #2 pal 34 peptidoglycan-associated lipoprotein Motif number 1 ACCGTCCGAACAGTCAACATCGCGA 1 6 0 CAGTCAACAT 0.994576 -127 ACTGTTCGGACGGTCAACATCAGGCACCGG 1 22 1 CGGTCAACAT 0.996549 -111 GTATTTTAGTTTGTTAACATTCTGCTAAAT 1 78 1 TTGTTAACAT 0.760641 -55 CGTGGGCCATCGGTCCAGATAAGGGAGATA 1 111 1 CGGTCCAGAT 0.994749 -22 ********** Masking position 4 Map Score: 5.42421 Number of sites scoring better than the average of aligned sites = 290 Number in coding regions = 270 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 TCGCGATGTTGACTGTTCGGA 1 2 1 CGCGATGTTG 0.991935 -131 GCAACCGGTGCCTGATGTTGACCGTCCGAA 1 26 0 CCTGATGTTG 0.980236 -107 CATATCTCCCTTATCTGGACCGATGGCC 1 115 0 CCTTATCTGG 0.772807 -18 ********** Masking position 5 Map Score: 0.871901 Number of sites scoring better than the average of aligned sites = 187 Number in coding regions = 166 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 ACGGGGTTCTGGTAGTTTTGTGTATTTTAG 1 57 1 GGTAGTTTTG 0.991561 -76 GGTAGTTTTGTGTATTTTAGTTTGTTAACA 1 67 1 TGTATTTTAG 0.980919 -66 GATGGCCCACGATAATTTAGCAGAATGTTA 1 92 0 GATAATTTAG 0.980619 -41 ********** Masking position 4 Map Score: 0.215971 Number of sites scoring better than the average of aligned sites = 83 Number in coding regions = 71 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 4 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0