AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i260_ecoli_mtub_100.orf -o260_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 fliC_fliD 265 fliC: flagellar biosynthesis; flagellin, filament structural protein, fliD: flagellar biosynthesis; filament capping protein; enables filament assembly #2 fliS 24 flagellar biosynthesis; repressor of class 3a and 3b operons (RflA activity) Motif number 1 GCGATTTCCTTTTATCTTTCGA 1 3 1 GATTTCCTTT 0.976819 -263 GATAACCCCGGTATTCGTTTTACGTGTCGA 1 29 0 GTATTCGTTT 0.97376 -237 ATTGCGCAAAGTTTACGTTTAATTGTTTTT 1 66 1 GTTTACGTTT 0.987748 -200 CGTCAACCCTGTTATCGTCTGTCGTAAAAC 1 181 0 GTTATCGTCT 0.979292 -85 GCAAGTCGTTGATTACGTATTGGGTTTCCA 1 228 0 GATTACGTAT 0.967903 -38 GATTCGTTATCCTATATTGCAAGTC 1 251 0 GTTATCCTAT 0.967114 -15 ********** Masking position 8 Map Score: 7.26182 Number of sites scoring better than the average of aligned sites = 297 Number in coding regions = 249 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 2 GGTATTCGTTTTACGTGTCGAAAGATAAAAGGA 1 17 0 TAGGTCGAAA 0.983614 -249 GTTATCGGTCTGAATTGCGCAAAGTTTACGTTT 1 53 1 TATGCGCAAA 0.976615 -213 ATTGTTTTTTTTAATAGCGGGAATAAGGGGCAG 1 87 1 TATGCGGGAA 0.987558 -179 ATAGCGGGAATAAGGGGCAGAGAAAAGAGTATT 1 100 1 TAGGCAGAGA 0.95958 -166 CCATTTTTTGTTAGTCGCCGAAATACTCTTTTC 1 121 0 TATGCCGAAA 0.99529 -145 ACCCGTCGGCTCAATCGCCGTCAACCCTGTTAT 1 196 0 TATGCCGTCA 0.951279 -70 GCGATTGAGCCGACGGGTGGAAACCCAATACGT 1 211 1 CAGGTGGAAA 0.956495 -55 * * * ******* Masking position 3 Map Score: 3.44995 Number of sites scoring better than the average of aligned sites = 732 Number in coding regions = 654 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 88 Fraction of orfs with sites within 600 bp upstream = 0.0141343 Motif number 3 CTTTCGACACGTAAAACGAATACCGGGGTT 1 26 1 GTAAAACGAA 0.852663 -240 CGAATACCGGGGTTATCGGTCTGAATTGCG 1 42 1 GGTTATCGGT 0.946321 -224 AGAGAAAAGAGTATTTCGGCGACTAACAAA 1 118 1 GTATTTCGGC 0.96881 -148 TCTAAAGGTTGTTTTACGACAGACGATAAC 1 171 1 GTTTTACGAC 0.973421 -95 ACGATAACAGGGTTGACGGCGATTGAGCCG 1 193 1 GGTTGACGGC 0.987123 -73 TTGCAATATAGGATAACGAATC 1 254 1 GGATAACGAA 0.973605 -12 ********** Masking position 7 Map Score: 2.80645 Number of sites scoring better than the average of aligned sites = 1907 Number in coding regions = 1792 Number in noncoding regions = 115 Number of orfs with sites within 600 bp upstream = 131 Fraction of orfs with sites within 600 bp upstream = 0.0210408 Motif number 4 GTTTACGTTTAATTGTTTTTTTTAATAGCGGG 1 76 1 AATGTTTTTT 0.986045 -190 TTAGTCGCCGAAATACTCTTTTCTCTGCCCCT 1 112 0 AATACTTTTT 0.958891 -154 ACTAACAAAAAATGGCTGTTTTTGAAAAAAAT 1 139 1 AAGGCTTTTT 0.994142 -127 AAAAAATTCTAAAGGTTGTTTTACGACAGACG 1 164 1 AAGGTTTTTT 0.990619 -102 ** **** **** Masking position 7 Map Score: 2.2123 Number of sites scoring better than the average of aligned sites = 68 Number in coding regions = 45 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 5 CGTAAAACGAATACCGGGGTTATCGGTCTGA 1 35 1 ATACGGGGTT 0.981871 -231 GTTTTTTTTAATAGCGGGAATAAGGGGCAGA 1 90 1 ATACGGGAAT 0.979035 -176 ACGACAGACGATAACAGGGTTGACGGCGATT 1 186 1 ATACAGGGTT 0.992846 -80 *** ******* Masking position 3 Map Score: 1.25512 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 8 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 6 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0