AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i288_ecoli_mtub_100.orf -o288_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 moxR 138 moxR Motif number 1 CGACGCCGCGGTGGTGCCCGGCAAATCACA 1 17 0 GTGGTGCCCG 0.997517 -122 CCTGGATTCCGTCGACGCCGCGGTGGTGCC 1 29 0 GTCGACGCCG 0.996464 -110 GCGGGGCAGCGACGCGCCCGCGTTCAACTA 1 69 0 GACGCGCCCG 0.99765 -70 CGACATGACCAACGTCGCGGGGCAGCGACG 1 85 0 AACGTCGCGG 0.975717 -54 CGCGACGTTGGTCATGTCGGCAGTCGTGTC 1 96 1 GTCATGTCGG 0.989331 -43 CATGTCGGCAGTCGTGTCCGATTGAGCTGT 1 108 1 GTCGTGTCCG 0.999129 -31 ********** Masking position 8 Map Score: 11.9424 Number of sites scoring better than the average of aligned sites = 1014 Number in coding regions = 970 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 ATTTGCCGGGCACCACCGCGGCGTCGACGG 1 21 1 CACCACCGCG 0.99392 -118 GCCTGGAATAGTTGAACGCGGGCGCGTCGC 1 61 1 GTTGAACGCG 0.939257 -78 CGTCGCGGGGCAGCGACGCGCCCGCGTTCA 1 73 0 CAGCGACGCG 0.982449 -66 CTGCCGACATGACCAACGTCGCGGGGCAGC 1 89 0 GACCAACGTC 0.964577 -50 CTCAATCGGACACGACTGCCGACATGACCA 1 104 0 CACGACTGCC 0.978664 -35 CAAAATCCTCCACAGCTCAATCGGACA 1 122 0 CTCCACAGCT 0.957321 -17 ********** Masking position 8 Map Score: 3.61907 Number of sites scoring better than the average of aligned sites = 6603 Number in coding regions = 6417 Number in noncoding regions = 186 Number of orfs with sites within 600 bp upstream = 189 Fraction of orfs with sites within 600 bp upstream = 0.0303566 Motif number 3 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -9.70439e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0