AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i307_ecoli_mtub_100.orf -o307_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 rph 126 RNase PH #2 Rv1335 21 hypothetical protein Rv1335 #3 Rv1339 26 hypothetical protein Rv1339 #4 Rv1341 38 hypothetical protein Rv1341 Motif number 1 CCTATCCTGACAAGGCATCGATGGCTATAA 1 46 0 CAAGGCATCG 0.943761 -81 GCTGGCCTTTCTCGGAACGGT 2 2 0 CTCGGAACGG 0.993577 -20 GGAAGAGATTCTCGTCACCGA 3 16 1 CTCGTCACCG 0.99832 -11 TCTGCATCGTCGCGGCGCGG 4 1 0 CGCGGCGCGG 0.989078 -38 CATCGCTCCGCTCTGCATCGTCGCGGCGCG 4 12 0 CTCTGCATCG 0.934969 -27 TCCTCCTCATCGCTCCGCTCTG 4 27 0 CTCCTCATCG 0.987705 -12 ********** Masking position 1 Map Score: 10.3219 Number of sites scoring better than the average of aligned sites = 1349 Number in coding regions = 1303 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 2 TGACAAGGCATCGATGGCTATAATCCTTCC 1 39 0 TCGATGGCTA 0.985043 -88 TCGGTGACGAGAATCTCTTC 3 17 0 TCGGTGACGA 0.923782 -10 CCGCGCCGCGACGATGCAGAGCGGAGCGAT 4 11 1 ACGATGCAGA 0.982398 -28 GCAGAGCGGAGCGATGAGGAGGA 4 26 1 GCGATGAGGA 0.993252 -13 ********** Masking position 5 Map Score: 1.60487 Number of sites scoring better than the average of aligned sites = 820 Number in coding regions = 796 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 3 TATACGGACTTCCGGCGGTTATTCCTATCC 1 69 0 TCCGGCGGTT 0.98795 -58 AACAAATGTGGCTGCGCATTATACGGACTT 1 88 0 GCTGCGCATT 0.980313 -39 TTTGTTTCAAGCCGGAGATTTCAAT 1 112 1 GCCGGAGATT 0.993124 -15 GCTGGCCTTTCTCGGAACGG 2 12 0 GCTGGCCTTT 0.992658 -10 ********** Masking position 9 Map Score: 0.838529 Number of sites scoring better than the average of aligned sites = 1274 Number in coding regions = 1183 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 80 Fraction of orfs with sites within 600 bp upstream = 0.0128493 Motif number 4 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0