AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i343_ecoli_mtub_100.orf -o343_ecoli_mtub_100.ace -a/home/amcguire/genomes/ORF_ecoli.txt -z/home/amcguire/genomes/ecoli.fna -g0.58 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.58 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 yiaY 189 putative oxidoreductase #2 Rv0692 164 hypothetical protein Rv0692 Motif number 1 CATTTCGGCACTCGATGCCATATTGTGTCC 2 25 1 CTCGATGCCA 0.979845 -140 AGATCGACGGATCGCTGTCGAGACCTGCTG 2 55 1 ATCGCTGTCG 0.991925 -110 CGGTGTCGGTATCGGTTTCGTAGTCCATCT 2 99 0 ATCGGTTTCG 0.9844 -66 CGGTGACAAGCTCGGTGTCGGTATCGGTTT 2 111 0 CTCGGTGTCG 0.998654 -54 CAACCAGGGTCTCGGTGACAAGCTCGGTGT 2 123 0 CTCGGTGACA 0.992385 -42 ********** Masking position 6 Map Score: 7.57316 Number of sites scoring better than the average of aligned sites = 284 Number in coding regions = 281 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 2 GGCATCGAGTGCCGAAATGGAAGGGCGAAT 2 14 0 GCCGAAATGG 0.979183 -151 ACAGCGATCCGTCGATCTGGACACAATATG 2 43 0 GTCGATCTGG 0.996606 -122 CCTTTCGCCAGCAGGTCTCGACAGCGATCC 2 63 0 GCAGGTCTCG 0.979678 -102 CGGTTTCGTAGTCCATCTGGATTGCCTTTC 2 87 0 GTCCATCTGG 0.98921 -78 CAAGCTCGGTGTCGGTATCGGTTTCGTAGT 2 105 0 GTCGGTATCG 0.990685 -60 ********** Masking position 8 Map Score: 5.08077 Number of sites scoring better than the average of aligned sites = 868 Number in coding regions = 853 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 ATTTTAAAACTTAATTAATCATTTCC 1 7 0 TTAATTAATC 0.973399 -183 AGTTTTAAAATAAATTAATACAAAATTCTT 1 26 1 TAAATTAATA 0.977845 -164 GTGCTTTTTTTAAATTCATAAGAATTTTGT 1 45 0 TAAATTCATA 0.941652 -145 AGCACATTGTTTAATGAATACAATGTGCTT 1 70 1 TTAATGAATA 0.952115 -120 ATTGATTATCAAAATTAATCTAATAAAAAG 1 97 0 AAAATTAATC 0.951485 -93 ATTAATTTTGATAATCAATAATACTGATCA 1 108 1 ATAATCAATA 0.914213 -82 ********** Masking position 5 Map Score: 4.84786 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 56 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 4 ATAAATTAATACAAAATTCTTATGAATTTA 1 35 1 ACAAAATTCT 0.862878 -155 TATTCATTAAACAATGTGCTTTTTTTAAAT 1 60 0 ACAATGTGCT 0.992056 -130 TTTAATGAATACAATGTGCTTTTTATTAGA 1 79 1 ACAATGTGCT 0.992056 -111 TTTTCATTCGAAAATATGATCAGTATTATT 1 124 0 AAAATATGAT 0.880192 -66 CGATCTGGACACAATATGGCATCGAGTGCC 2 31 0 ACAATATGGC 0.929312 -134 ********** Masking position 4 Map Score: 3.02168 Number of sites scoring better than the average of aligned sites = 209 Number in coding regions = 183 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 5 TTTAAATTCATAAGAATTTTGTATTAATTT 1 37 0 TAAGAATTTT 0.854532 -153 CATTAAACAATGTGCTTTTTTTAAATTCAT 1 56 0 TGTGCTTTTT 0.983423 -134 ATGAATACAATGTGCTTTTTATTAGATTAA 1 83 1 TGTGCTTTTT 0.983423 -107 TCAATAATACTGATCATATTTTCGAATGAA 1 122 1 TGATCATATT 0.876456 -68 GGCAGCTTACTGAGGATTTTCATTCGAAAA 1 140 0 TGAGGATTTT 0.978466 -50 ********** Masking position 7 Map Score: 1.70129 Number of sites scoring better than the average of aligned sites = 614 Number in coding regions = 519 Number in noncoding regions = 95 Number of orfs with sites within 600 bp upstream = 107 Fraction of orfs with sites within 600 bp upstream = 0.017186 Motif number 6 TAATACAAAATTCTTATGAATTTAAAAAAA 1 41 1 TTCTTATGAA 0.809257 -149 ATCAAAATTAATCTAATAAAAAGCACATTG 1 90 0 ATCTAATAAA 0.860943 -100 TGATCATATTTTCGAATGAAAATCCTCAGT 1 132 1 TTCGAATGAA 0.972919 -58 TTGTGTCCAGATCGACGGATCGCTGTCGAG 2 47 1 ATCGACGGAT 0.961889 -118 AGAGGTGTCCATCGACGGAAT 2 154 1 ATCGACGGAA 0.987784 -11 ********** Masking position 2 Map Score: 0.831716 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 265 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 61 Fraction of orfs with sites within 600 bp upstream = 0.00979762 Motif number 7 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0