AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i002_mgen_mpneu_100.orf -o002_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00101 91 Mycoplasma #2 RMP00093 55 Mycoplasma_pneumoniae Motif number 1 GATGCTTGATAACATTGCTTTGAACATGATT 1 23 1 AACATTCTTT 0.984083 -69 CATTGCTTTGAACATGATTTTTAATTATTTA 1 35 1 AACATGTTTT 0.960798 -57 ATGATTTTTAATTATTTATTATTAAATAATG 1 48 1 ATTATTATTA 0.953249 -44 GTTTTATTAAAACATTATTTAATAATAAATA 1 60 0 AACATTTTTA 0.980099 -32 ATTGCAATATTGTTTTATTAAAACAT 1 76 0 AATATTTTTT 0.990578 -16 tatttttttatttattaatttcgtgg 2 6 0 tttattattt 0.906797 -50 atgcatctttattatttttttatttattaat 2 18 0 attatttttt 0.988664 -38 ****** **** Masking position 4 Map Score: 10.5706 Number of sites scoring better than the average of aligned sites = 306 Number in coding regions = 275 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 AATAATAAATAATTAAAAATCATGTTCAAA 1 41 0 AATTAAAAAT 0.968411 -51 AATTATTTATTATTAAATAATGTTTTAATA 1 57 1 TATTAAATAA 0.955237 -35 AATAATGTTTTAATAAAACAATATTGCAAT 1 72 1 TAATAAAACA 0.954549 -20 cgaaattaataaataaaaaaataataaaga 2 14 1 aaataaaaaa 0.982779 -42 aataaaaaaataataaagatgcatatctat 2 25 1 taataaagat 0.971261 -31 ctttgatcgaaatagatatgcatctttat 2 37 0 aaatagatat 0.936054 -19 ********** Masking position 5 Map Score: 6.36406 Number of sites scoring better than the average of aligned sites = 497 Number in coding regions = 392 Number in noncoding regions = 105 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 3 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0