AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i002_mgen_mpneu_300.orf -o002_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00101 91 Mycoplasma #2 RMP00093 55 Mycoplasma_pneumoniae Motif number 1 AATCATGTTCAAAGCAATGTTATCAAGCATC 1 23 0 AAAGAATGTT 0.984332 -69 TAAATAATTAAAAATCATGTTCAAAGCAATG 1 35 0 AAAACATGTT 0.9609 -57 CATTATTTAATAATAAATAATTAAAAATCAT 1 48 0 TAATAATAAT 0.95396 -44 TATTTATTATTAAATAATGTTTTAATAAAAC 1 60 1 TAAAAATGTT 0.9803 -32 ATGTTTTAATAAAACAATATTGCAAT 1 76 1 AAAAAATATT 0.990704 -16 ccacgaaattaataaataaaaaaata 2 6 1 aaataataaa 0.908146 -50 attaataaataaaaaaataataaagatgcat 2 18 1 aaaaaataat 0.988842 -38 **** ****** Masking position 7 Map Score: 10.5706 Number of sites scoring better than the average of aligned sites = 306 Number in coding regions = 275 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 2 TTGAACATGATTTTTAATTATTTATTATTA 1 42 1 TTTTTAATTA 0.918186 -50 TTTTAATTATTTATTATTAAATAATGTTTT 1 53 1 TTATTATTAA 0.673374 -39 TTGCAATATTGTTTTATTAAAACATTATTT 1 71 0 GTTTTATTAA 0.982597 -21 ctttattatttttttatttattaatttcgt 2 13 0 tttttattta 0.987468 -43 tagatatgcatctttattatttttttattt 2 24 0 tctttattat 0.955314 -32 ********** Masking position 5 Map Score: 6.6303 Number of sites scoring better than the average of aligned sites = 293 Number in coding regions = 243 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 3 GTTATCAAGCATCGTTATGCGCACG 1 6 0 ATCGTTATGC 0.996208 -86 tttgatcgaaatagatatgcatctttatta 2 35 0 atagatatgc 0.994118 -21 ********** Masking position 6 Map Score: 0.392231 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 1 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0