AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i009_mgen_mpneu_100.orf -o009_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00426 270 Mycoplasma #2 RMG01505 45 Mycoplasma #3 RMG02531 69 Mycoplasma #4 RMP00517 300 Mycoplasma_pneumoniae Motif number 1 AGTCATTTCATTTTGGACAAAAAGAAATTT 1 235 1 TTTTGGACAA 0.961454 -36 ttctgtgatttttcggcaaaatcgtcgagt 4 79 0 tttcggcaaa 0.985645 -222 aatcacagaatattcgcgaatctttcggaa 4 99 1 tattcgcgaa 0.963219 -202 ttcgcgaatctttcggaaaagacacggtaa 4 111 1 tttcggaaaa 0.945889 -190 ttgttacaattattggcgaacattcggggg 4 181 0 tattggcgaa 0.986961 -120 ttgttacaattattggacaattttgttaca 4 203 0 tattggacaa 0.952818 -98 aacgtcacaattttggcgaaatttcgaata 4 257 1 ttttggcgaa 0.991309 -44 tcgaaatttttttccgcaaatt 4 289 1 tttccgcaaa 0.913678 -12 ********** Masking position 9 Map Score: 13.2158 Number of sites scoring better than the average of aligned sites = 26 Number in coding regions = 24 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 ATTATAAAACTTTGGCACTTTTAGATTTAGAT 1 36 0 TTTGGCTTTT 0.966267 -235 TGGTAGGCTTTTTTATTGTTTTGTAGTTTATC 1 184 1 TTTTATTTTT 0.919675 -87 CCGCTTTTTATTTTGTTTTTTTAATAAACATT 3 11 0 TTTTGTTTTT 0.938893 -59 gtattctgttttttatgtttttcgtaagtcgc 4 14 1 ttttattttt 0.919675 -287 tatcaattaactcgacgattttgccgaaaaat 4 70 1 ctcgactttt 0.887608 -231 ttcgcgaatattctgtgatttttcggcaaaat 4 87 0 ttctgttttt 0.967936 -214 aaaatccgagttcgatccttttaccgtgtctt 4 129 0 ttcgattttt 0.977161 -172 ttggcgaacattcgggggttttgccggacatc 4 167 0 ttcgggtttt 0.954533 -134 gttacaattattggacaattttgttacaatta 4 199 0 ttggactttt 0.946512 -102 ttcgccaaaattgtgacgtttttactcgatta 4 245 0 ttgtgatttt 0.847128 -56 tttcgaatatttcgaaatttttttccgcaaat 4 278 1 ttcgaatttt 0.949012 -23 ****** **** Masking position 9 Map Score: 12.3004 Number of sites scoring better than the average of aligned sites = 204 Number in coding regions = 186 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 TCAATTATAAAACTTTGGCACTTTTAGATT 1 41 0 AACTTTGGCA 0.891457 -230 GTAGTCATTTCATTTTGGACAAAAAGAAAT 1 233 1 CATTTTGGAC 0.802118 -38 gttaattgataagtttggccaccaattctc 4 51 0 aagtttggcc 0.929613 -250 atattctgtgatttttcggcaaaatcgtcg 4 82 0 atttttcggc 0.865431 -219 aaaatcacagaatattcgcgaatctttcgg 4 97 1 aatattcgcg 0.971147 -204 attattggcgaacattcgggggttttgccg 4 173 0 aacattcggg 0.874094 -128 ttttgttacaattattggcgaacattcggg 4 183 0 attattggcg 0.957475 -118 ttttgttacaattattggacaattttgtta 4 205 0 attattggac 0.897971 -96 aaaacgtcacaattttggcgaaatttcgaa 4 255 1 aattttggcg 0.980286 -46 aaaatttcgaaatattcgaaatttcgccaa 4 269 0 aatattcgaa 0.816369 -32 ********** Masking position 5 Map Score: 6.03455 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 34 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 TAGATGTGATTAATAGACAAAAGGAGTTAT 1 11 0 TAATAGACAA 0.966177 -260 CAAAGTTTTATAATTGATCAACTGTCATCA 1 54 1 TAATTGATCA 0.868652 -217 TAACCCTTGATAAACTACAAAACAATAAAA 1 194 0 TAAACTACAA 0.874323 -77 ATAGCAATTCTAAACGATAAATTAAATTAA 2 11 0 TAAACGATAA 0.962382 -35 ATAACCTGTCTAAAAGACAATTTC 3 56 1 TAAAAGACAA 0.96675 -14 atcgtcgagttaattgataagtttggccac 4 59 0 taattgataa 0.945904 -242 ********** Masking position 7 Map Score: 2.72287 Number of sites scoring better than the average of aligned sites = 80 Number in coding regions = 74 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 CTTTGGCACTTTTAGATTTAGATGTGATTA 1 29 0 TTTAGATTTA 0.884851 -242 GTGCCAAAGTTTTATAATTGATCAACTGTC 1 50 1 TTTATAATTG 0.909141 -221 TAATTTATCGTTTAGAATTGCTATCTTAAG 2 17 1 TTTAGAATTG 0.964655 -29 ggacaattttgttacaattattggcgaaca 4 189 0 gttacaatta 0.964655 -112 ggaaaattttgttacaattattggacaatt 4 211 0 gttacaatta 0.964655 -90 ********** Masking position 6 Map Score: 1.2159 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 10 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 6 ggcaaaatcgtcgagttaattgataagttt 4 65 0 tcgagttaat 0.948909 -236 cgagtaaaatccgagttcgatccttttacc 4 136 0 ccgagttcga 0.956818 -165 gccggacatcccgagtaaaatccgagttcg 4 147 0 ccgagtaaaa 0.986414 -154 tccgaggtaatcgagtaaaaacgtcacaat 4 238 1 tcgagtaaaa 0.979134 -63 ********** Masking position 6 Map Score: 0.283274 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 1 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 AACCGCTTTTTATTTTGTTTTTTTAATAAA 3 15 0 TATTTTGTTT 0.965547 -55 acggtattctgttttttatgtttt 4 5 1 tattctgttt 0.968003 -296 gattcgcgaatattctgtgatttttcggca 4 91 0 tattctgtga 0.951288 -210 attattggacaattttgttacaattattgg 4 195 0 aattttgtta 0.965547 -106 tacctcggaaaattttgttacaattattgg 4 217 0 aattttgtta 0.965547 -84 ********** Masking position 6 Map Score: 3.78752 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 51 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 8 AACTTTATTTGCCTATCAGTTAAATAACTGGT 1 156 1 GCTATCATTA 0.980704 -115 CAATAAAAAAGCCTACCAGTTATTTAACTGAT 1 170 0 GCTACCATTA 0.995072 -101 AAAATGAAATGACTACAACTTAAATTAACCCT 1 217 0 GCTACAATTA 0.980703 -54 tgataagtttggccaccaattctctatttgcg 4 43 0 gccaccattc 0.985811 -258 * ****** *** Masking position 5 Map Score: 0.013119 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 0 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 9 ********** No masking Map Score: -1.0918e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -1.0918e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: -1.0918e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0