AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i009_mgen_mpneu_300.orf -o009_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00426 270 Mycoplasma #2 RMG01505 45 Mycoplasma #3 RMG02531 69 Mycoplasma #4 RMP00517 300 Mycoplasma_pneumoniae Motif number 1 AAAATTTCTTTTTGTCCAAAATGAAATGACTA 1 234 0 TTTGCCAAAT 0.94804 -37 aattgataagtttggccaccaattctctattt 4 46 0 tttgccacaa 0.944836 -255 actcgacgattttgccgaaaaatcacagaata 4 79 1 tttgcgaaaa 0.880849 -222 tttccgaaagattcgcgaatattctgtgattt 4 98 0 attccgaaat 0.95069 -203 attcgggggttttgccggacatcccgagtaaa 4 158 0 tttgcggaat 0.963422 -143 tgttacaattattggcgaacattcgggggttt 4 178 0 attgcgaaat 0.983993 -123 ttgtaacaaaattgtccaataattgtaacaaa 4 202 1 attgccaaaa 0.972995 -99 atattcgaaatttcgccaaaattgtgacgttt 4 256 0 tttcccaaat 0.967181 -45 aatttgcggaaaaaaatttcgaaa 4 287 0 tttgggaaaa 0.848105 -14 **** **** ** Masking position 3 Map Score: 12.6334 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 19 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 CGCAAGCTGATACTCTGTCCTATTGAGCTATGA 1 81 0 TACTTGTTAT 0.906542 -190 GCTTTTTTATTGTTTTGTAGTTTATCAAGGGTT 1 190 1 TGTTTGTTTT 0.962104 -81 AACCGCTTTTTATTTTGTTTTTTTAATAAACAT 3 12 0 TATTTGTTTT 0.989647 -58 acggtattctgttttttatgtttttcg 4 5 1 tatttgtttt 0.989647 -296 gattcgcgaatattctgtgatttttcggcaaaa 4 88 0 tatttgtttt 0.989646 -213 tcgatccttttaccgtgtcttttccgaaagatt 4 117 0 tacctgtttt 0.934966 -184 atttcgccaaaattgtgacgtttttactcgatt 4 246 0 aatttgattt 0.862405 -55 aaatttcgaatatttcgaaatttttttccgcaa 4 275 1 tattcgattt 0.902857 -26 **** *** *** Masking position 11 Map Score: 7.53868 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 25 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 TTAGATGTGATTAATAGACAAAAGGAGTTAT 1 10 0 TTAATGAAAA 0.75071 -261 TGATAAACTACAAAACAATAAAAAAGCCTACC 1 185 0 CAAAAAAAAA 0.876079 -86 TCTTTTTGTCCAAAATGAAATGACTACAACTT 1 228 0 CAAAAGAATG 0.946941 -43 TCATTTTGGACAAAAAGAAATTTTTATGCTAA 1 242 1 CAAAAGAATT 0.919031 -29 GATAGCAATTCTAAACGATAAATTAAATTAA 2 10 0 CTAAAGAAAA 0.966668 -36 ATTAAAAAAACAAAATAAAAAGCGGTTTTATA 3 18 1 CAAAAAAAAG 0.9175 -52 TATAACCTGTCTAAAAGACAATTTC 3 55 1 CTAAAGAAAT 0.966837 -15 tcgtaagtcgcaaatagagaattggtggccaa 4 35 1 caaatgaaat 0.9496 -266 aatcgtcgagttaattgataagtttggccacc 4 58 0 ttaatgaaag 0.822903 -243 ***** ** *** Masking position 8 Map Score: 5.50221 Number of sites scoring better than the average of aligned sites = 214 Number in coding regions = 195 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 4 CACTTTTAGATTTAGATGTGATTAATAGACAAAA 1 19 0 TTAGTGGATA 0.978891 -252 CTCTGTCCTATTGAGCTATGATGACAGTTGATCA 1 68 0 TTAGTAGATA 0.982423 -203 AAGGGTTAATTTAAGTTGTAGTCATTTCATTTTG 1 216 1 TTAGTGAGTA 0.915135 -55 AAAGAAATTTTTATGCTAAGATAAAA 1 255 1 TTTGTAGATA 0.899154 -16 tattggacaattttgttacaattattggcgaaca 4 189 0 tttgtaaata 0.972418 -112 cctcggaaaattttgttacaattattggacaatt 4 211 0 tttgtaaata 0.972418 -90 ** ** ** *** * Masking position 7 Map Score: 2.9132 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 14 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 AATCTAAAAGTGCCAAAGTTTTATAATTGA 1 41 1 TGCCAAAGTT 0.924595 -230 cgacgattttgccgaaaaatcacagaatat 4 82 1 gccgaaaaat 0.888397 -219 ccgaaagattcgcgaatattctgtgatttt 4 97 0 cgcgaatatt 0.971537 -204 ccgtgtcttttccgaaagattcgcgaatat 4 108 0 tccgaaagat 0.939397 -193 cggcaaaacccccgaatgttcgccaataat 4 173 1 cccgaatgtt 0.967849 -128 cccgaatgttcgccaataattgtaacaaaa 4 183 1 cgccaataat 0.872731 -118 ctcgattacctcggaaaattttgttacaat 4 223 0 tcggaaaatt 0.861606 -78 ttcgaaatttcgccaaaattgtgacgtttt 4 255 0 cgccaaaatt 0.956844 -46 ttggcgaaatttcgaatatttcgaaatttt 4 269 1 ttcgaatatt 0.83554 -32 gaaatttttttccgcaaatt 4 291 1 tccgcaaatt 0.909313 -10 ********** Masking position 6 Map Score: 7.19626 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 16 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 aaacttatcaattaactcgacgattttgcc 4 65 1 attaactcga 0.950835 -236 ggtaaaaggatcgaactcggattttactcg 4 136 1 tcgaactcgg 0.958088 -165 cgaactcggattttactcgggatgtccggc 4 147 1 ttttactcgg 0.986946 -154 attgtgacgtttttactcgattacctcgga 4 238 0 ttttactcga 0.979944 -63 ********** Masking position 5 Map Score: 0.283274 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 1 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.0918e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.0918e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.0918e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0