AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i010_mgen_mpneu_300.orf -o010_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.36
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Purged sequences:
RMG04575	66	Mycoplasma

Input sequences:
#1	RMG01607	66	Mycoplasma
#2	RMP00442	255	Mycoplasma_pneumoniae

Motif number 1

GCGCTTTTTGAACCTCACTAACTATTTTTA	1	17	1	AACCTCACTA	    0.993542	-50
caatcgcaggaacctgaataccaaattttt	2	68	1	aacctgaata	     0.99464	-188
cttaataaaaaccatcaatattcgaagatt	2	151	0	accatcaata	    0.959677	-105
aacccggacaaaccttaataaaaaccatca	2	164	0	aaccttaata	    0.991733	-92
gagaatttctaaccttaataggaccagaat	2	200	0	aaccttaata	    0.991733	-56
      ggtcaccctgactttttcgcccaa	2	242	0	accctgactt	    0.969198	-14
          **********

Masking position 5
Map Score:   10.658

Number of sites scoring better than the average of aligned sites = 41
Number in coding regions = 37
Number in noncoding regions = 4
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 2

AAGTTATTAAAAATAGTTAGTGAGGTTCAAA	1	23	0	AAATAGTAGT	    0.982389	-44
ATATTTATATAAAATTTAAGTTATTAAAAAT	1	40	0	AAAATTTAGT	    0.965462	-27
AATTTTATATAAATATTAAGTA         	1	55	1	AAATATTAGT	    0.981163	-12
gtgacaaataaaaaatttggtattcaggttc	2	77	0	aaaaattggt	    0.977371	-179
ttaaggttagaaattctcggtcagtttcctt	2	212	1	aaattctggt	    0.931479	-44
cctttgggcgaaaaagtcagggtgacc    	2	239	1	aaaaagtagg	    0.953676	-17
          ******* ***

Masking position 7
Map Score:   4.9877

Number of sites scoring better than the average of aligned sites = 86
Number in coding regions = 75
Number in noncoding regions = 11
Number of orfs with sites within 600 bp upstream = 13
Fraction of orfs with sites within 600 bp upstream = 0.00208802


Motif number 3

    AGAAAAGCGCTTTTTGAACCTCACTA	1	7	1	GCGCTTTTTG	    0.978154	-60
atctaggatgggtctttttcctgccgttac	2	31	0	ggtctttttc	    0.993995	-225
tcaggttcctgcgattgttcctcaatctag	2	55	0	gcgattgttc	    0.931755	-201
aggtttgtccgggttttttcgattctggtc	2	179	1	gggttttttc	    0.986223	-77
agaaattctcggtcagtttcctttgggcga	2	220	1	ggtcagtttc	    0.937298	-36
  ggtcaccctgactttttcgcccaaagga	2	238	0	tgactttttc	    0.935676	-18
          **********

Masking position 8
Map Score:   3.00881

Number of sites scoring better than the average of aligned sites = 80
Number in coding regions = 74
Number in noncoding regions = 6
Number of orfs with sites within 600 bp upstream = 3
Fraction of orfs with sites within 600 bp upstream = 0.00048185


Motif number 4

agtcataacaatggcgacggtaacggcagg	2	12	1	atggcgacgg	    0.984732	-244
tattcaggttcctgcgattgttcctcaatc	2	58	0	cctgcgattg	    0.905296	-198
acaagttgccaaggtgatggtggtgacaaa	2	100	0	aaggtgatgg	    0.982221	-156
accttggcaacttgtgatggggattcgctg	2	115	1	cttgtgatgg	    0.989819	-141
aaatcttcgaatattgatggtttttattaa	2	150	1	atattgatgg	     0.90731	-106
          **********

Masking position 7
Map Score:   0.487701

Number of sites scoring better than the average of aligned sites = 50
Number in coding regions = 42
Number in noncoding regions = 8
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 5

          **********

No masking
Map Score:   -5.09159e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   -5.09159e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   -5.09159e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0