AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i035_mgen_mpneu_100.orf -o035_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00346 300 Mycoplasma_pneumoniae #2 RMP00348 300 Mycoplasma_pneumoniae #3 RMP00349 291 Mycoplasma_pneumoniae Motif number 1 taaccccaggccttcggtttctcgtgggac 1 81 0 ccttcggttt 0.938037 -220 aaaccgaaggcctggggttaagaattaatt 1 91 1 cctggggtta 0.988796 -210 taaagatttacctgcaatttaccaaattca 1 194 1 cctgcaattt 0.761608 -107 acttagtggacttgggctttgttaaacaca 2 20 1 cttgggcttt 0.982281 -281 aacacattaccctggccttagatgcggggc 2 44 1 cctggcctta 0.990935 -257 ccaaagcactccttccctttttctaaacca 2 95 0 ccttcccttt 0.949372 -206 ggaaggagtgctttgggtttgcatatctgt 2 109 1 ctttgggttt 0.917261 -192 tcgctgaaatcctggcctttgatgcaccgc 2 214 1 cctggccttt 0.992361 -87 gatgcacagccttgggattaaactgccgcg 2 241 0 cttgggatta 0.927147 -60 tgctcgtacccatgccgttaccacaagcgg 3 41 0 catgccgtta 0.869639 -251 ccccaacaatcttggccttagcattcgggt 3 215 0 cttggcctta 0.979014 -77 ********** Masking position 3 Map Score: 16.4146 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 42 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 gtttctcgtgggactaaaacactacaatag 1 65 0 ggactaaaac 0.961931 -236 catcgaatgtgtaataatcccaataaagtt 1 227 0 gtaataatcc 0.67547 -74 ggcgggtactgtaccaaaacactatggttt 2 71 1 gtaccaaaac 0.825113 -230 tttaaggagcggaataaagcgttcaaacag 2 135 0 ggaataaagc 0.86659 -166 cacagccttgggattaaactgccgcggtgc 2 237 0 ggattaaact 0.863982 -64 tgttttttaagtgctaatacccgtggatgc 2 266 0 gtgctaatac 0.77982 -35 tgaaggagttgggctacaccgccaaagtgg 3 101 1 gggctacacc 0.946356 -191 ctttgtcaatgggacaaaccaaggggatgg 3 134 1 gggacaaacc 0.951304 -158 cttagcattcgggttaaactcactcgttaa 3 199 0 gggttaaact 0.900135 -93 gattgttggggtgttaaacctgatggatga 3 234 1 gtgttaaacc 0.928355 -58 taaacctgatggatgaaaacgaaattaagc 3 248 1 ggatgaaaac 0.810485 -44 ********** Masking position 6 Map Score: 6.20627 Number of sites scoring better than the average of aligned sites = 157 Number in coding regions = 139 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 cttaaccccaggccttcggtttctcgtggg 1 83 0 ggccttcggt 0.982084 -218 tcaacatttcgaccgttgataaaaatctta 1 276 1 gaccgttgat 0.900118 -25 tagtggacttgggctttgttaaacacatta 2 23 1 gggctttgtt 0.935304 -278 acattaccctggccttagatgcggggcggg 2 47 1 ggccttagat 0.991086 -254 ctgaaatcctggcctttgatgcaccgcggc 2 217 1 ggcctttgat 0.993762 -84 caacaatcttggccttagcattcgggttaa 3 212 0 ggccttagca 0.941483 -80 ********** Masking position 6 Map Score: 3.95517 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 1 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ctccttaaagaagtgggagtttccgatgcgg 2 156 1 agtgggagtt 0.991845 -145 attttcgaccaagatggtgttaatggccgca 2 182 0 agatggtgtt 0.851991 -119 agcggcaataatgtgtaagttcttattttcc 3 15 0 agtgtaagtt 0.932904 -277 tgaaaagattatgaaggagttgggctacacc 3 90 1 agaaggagtt 0.958909 -202 tacaccgccaaagtggaagctttgtcaatgg 3 115 1 agtggaagct 0.937638 -177 gattcacttaacgagtgagtttaacccgaat 3 192 1 agagtgagtt 0.976275 -100 * ********* Masking position 1 Map Score: 1.92314 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 31 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 cctggccttagatgcggggcgggtactgtac 2 54 1 gatgcgggcg 0.978823 -247 cctggcctttgatgcaccgcggcagtttaat 2 224 1 gatgcacgcg 0.997239 -77 aatacccgtggatgcacagccttgggattaa 2 250 0 gatgcacgcc 0.995984 -51 aaggagttgggctacaccgccaaagtggaag 3 103 1 gctacacgcc 0.965362 -189 ccaaggggatggagcacagcgctgacattat 3 152 1 ggagcacgcg 0.984711 -140 ******* *** Masking position 5 Map Score: 2.99923 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 1 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 attcctaaatccataaacactgacagtgct 1 125 0 ccataaacac 0.956719 -176 aacatttcgaccgttgataaaaatcttagt 1 278 1 ccgttgataa 0.878161 -23 tccgatgcggccattaacaccatcttggtc 2 177 1 ccattaacac 0.986369 -124 cgtacccatgccgttaccacaagcggcaat 3 37 0 ccgttaccac 0.972486 -255 ttggtttgtcccattgacaaagcttccact 3 126 0 ccattgacaa 0.972101 -166 ********** Masking position 4 Map Score: 1.31714 Number of sites scoring better than the average of aligned sites = 40 Number in coding regions = 37 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 7 gaggctggtggtaccacctgttt 1 4 1 gctggtggta 0.986075 -297 aaagttatgtgaatttggtaaattgcaggt 1 203 0 gaatttggta 0.890431 -98 ataggtcatcgaatgtgtaataatcccaat 1 233 0 gaatgtgtaa 0.851212 -68 tttcgaccaagatggtgttaatggccgcat 2 181 0 gatggtgtta 0.966794 -120 cattattgccgcttgtggtaacggcatggg 3 33 1 gcttgtggta 0.984985 -259 ********** Masking position 6 Map Score: 0.390216 Number of sites scoring better than the average of aligned sites = 51 Number in coding regions = 44 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ttaatttactagcactgtcagtgtttatgg 1 115 1 agcactgtca 0.979647 -186 cacgggtattagcacttaaaaaacaactaa 2 271 1 agcacttaaa 0.951905 -30 atggaaaataagaacttacacattattgcc 3 13 1 agaacttaca 0.951875 -279 gatggagcacagcgctgacattattatttc 3 159 1 agcgctgaca 0.986178 -133 ********** Masking position 6 Map Score: 0.0635516 Number of sites scoring better than the average of aligned sites = 17 Number in coding regions = 14 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 9 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0