AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i035_mgen_mpneu_300.orf -o035_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00346 300 Mycoplasma_pneumoniae #2 RMP00348 300 Mycoplasma_pneumoniae #3 RMP00349 291 Mycoplasma_pneumoniae Motif number 1 gtcccacgagaaaccgaaggcctggggtta 1 81 1 aaaccgaagg 0.930803 -220 aattaattcttaaccccaggccttcggttt 1 91 0 taaccccagg 0.987408 -210 tgaatttggtaaattgcaggtaaatcttta 1 194 0 aaattgcagg 0.739495 -107 tgtgtttaacaaagcccaagtccactaagt 2 20 0 aaagcccaag 0.980103 -281 gccccgcatctaaggccagggtaatgtgtt 2 44 0 taaggccagg 0.98981 -257 tggtttagaaaaagggaaggagtgctttgg 2 95 1 aaagggaagg 0.943381 -206 acagatatgcaaacccaaagcactccttcc 2 109 0 aaacccaaag 0.907839 -192 gcggtgcatcaaaggccaggatttcagcga 2 214 0 aaaggccagg 0.991411 -87 cgcggcagtttaatcccaaggctgtgcatc 2 241 1 taatcccaag 0.918751 -60 ccgcttgtggtaacggcatgggtacgagca 3 41 1 taacggcatg 0.855648 -251 acccgaatgctaaggccaagattgttgggg 3 215 1 taaggccaag 0.976444 -77 ********** Masking position 3 Map Score: 16.4146 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 42 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 2 agcttacttcgacgataatttctcacaaaca 1 36 0 gacataattt 0.92003 -265 aggggattttgacaagaatgtttagaaaagt 1 164 1 gacagaatgt 0.955536 -137 ccgactaagatttttatcaacgg 1 288 0 gacaagattt 0.971467 -13 cgagattttcgaccaagatggtgttaatggc 2 186 0 gacaagatgg 0.965117 -115 gtgcatcaaaggccaggatttcagcgagatt 2 210 0 ggcaggattt 0.977966 -91 taccacaagcggcaataatgtgtaagttctt 3 22 0 ggcataatgt 0.943748 -270 cgaatgctaaggccaagattgttggggtgtt 3 218 1 ggcaagattg 0.965117 -74 *** ******* Masking position 5 Map Score: 5.00639 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 12 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 gataatttctcacaaacattaaacaggtgg 1 24 0 cacaaacatt 0.820275 -277 tctcgtgggactaaaacactacaatagctt 1 62 0 ctaaaacact 0.906266 -239 agaattaatttactagcactgtcagtgttt 1 111 1 tactagcact 0.842675 -190 ttcctaaatccataaacactgacagtgcta 1 124 0 cataaacact 0.964766 -177 tctttacttttctaaacattcttgtcaaaa 1 170 0 tctaaacatt 0.762369 -131 gggtactgtaccaaaacactatggtttaga 2 74 1 ccaaaacact 0.966231 -227 atatgcaaacccaaagcactccttcccttt 2 105 0 ccaaagcact 0.974618 -196 ccgatgcggccattaacaccatcttggtcg 2 178 1 cattaacacc 0.861036 -123 catccacgggtattagcacttaaaaaacaa 2 267 1 tattagcact 0.888391 -34 acaatcttggccttagcattcgggttaaac 3 210 0 ccttagcatt 0.873565 -82 cttaaagcaccttacttaacg 3 281 0 ttaaagcacc 0.646588 -11 ********** Masking position 5 Map Score: 6.57879 Number of sites scoring better than the average of aligned sites = 282 Number in coding regions = 263 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 4 cctggcctttgatgcaccgcggcagtttaat 2 224 1 gtgcaccgcg 0.997805 -77 aatacccgtggatgcacagccttgggattaa 2 250 0 gtgcacagcc 0.996608 -51 aaggagttgggctacaccgccaaagtggaag 3 103 1 gtacaccgcc 0.991335 -189 ccaaggggatggagcacagcgctgacattat 3 152 1 gagcacagcg 0.991476 -140 * ********* Masking position 6 Map Score: 3.48545 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ctccttaaagaagtgggagtttccgatgcgg 2 156 1 agtgggagtt 0.992555 -145 attttcgaccaagatggtgttaatggccgca 2 182 0 agatggtgtt 0.863225 -119 agcggcaataatgtgtaagttcttattttcc 3 15 0 agtgtaagtt 0.938441 -277 tgaaaagattatgaaggagttgggctacacc 3 90 1 agaaggagtt 0.962386 -202 tacaccgccaaagtggaagctttgtcaatgg 3 115 1 agtggaagct 0.942801 -177 gattcacttaacgagtgagtttaacccgaat 3 192 1 agagtgagtt 0.978316 -100 * ********* Masking position 1 Map Score: 1.92314 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 31 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 cagtgtttatggatttaggaatcccagtta 1 133 1 ggatttagga 0.939036 -168 cagttacaggggattttgacaagaatgttt 1 157 1 ggattttgac 0.939036 -144 aatacttagtggacttgggctttgttaaac 2 17 1 ggacttgggc 0.992282 -284 tcaaaggccaggatttcagcgagattttcg 2 206 0 ggatttcagc 0.958034 -95 agattatgaaggagttgggctacaccgcca 3 95 1 ggagttgggc 0.992283 -197 ********** Masking position 5 Map Score: 1.32677 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 5 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 7 gccgcatcggaaactcccacttctttaagg 2 158 0 aaactcccac 0.991352 -143 ccttgggattaaactgccgcggtgcatcaa 2 232 0 aaactgccgc 0.97336 -69 tggaaaataagaacttacacattattgccg 3 14 1 gaacttacac 0.936776 -278 cccattgacaaagcttccactttggcggtg 3 117 0 aagcttccac 0.970917 -175 cattcgggttaaactcactcgttaagtgaa 3 194 0 aaactcactc 0.952686 -98 ********** Masking position 5 Map Score: 0.567454 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 13 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 gtttctcgtgggactaaaacactacaatag 1 65 0 ggactaaaac 0.930324 -236 ttttatcaacggtcgaaatgttgacaatta 1 270 0 ggtcgaaatg 0.92977 -31 acaccatcttggtcgaaaatctcgctgaaa 2 193 1 ggtcgaaaat 0.941349 -108 taatacccgtggatgcacagccttgggatt 2 252 0 ggatgcacag 0.893589 -49 tcaagattaaggttgaaaagattatgaagg 3 77 1 ggttgaaaag 0.981267 -215 tcatccatcaggtttaacaccccaacaatc 3 234 0 ggtttaacac 0.905277 -58 taaacctgatggatgaaaacgaaattaagc 3 248 1 ggatgaaaac 0.97561 -44 ********** Masking position 7 Map Score: 3.2408 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 41 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 9 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: 1.63668e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0