AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i055_mgen_mpneu_300.orf -o055_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMP00283 53 Mycoplasma_pneumoniae #2 RMP00531 247 Mycoplasma_pneumoniae #3 RMP00533 300 Mycoplasma_pneumoniae Motif number 1 ggaagtaacgcaattaaagcaatt 1 5 1 gtaacgcaat 0.942929 -49 gaattttccagcatcggaactgagacgaaa 2 49 1 gcatcggaac 0.902705 -199 catcggaactgagacgaaatttgaaatgat 2 60 1 gagacgaaat 0.96989 -188 aactggagcggtaactaaattttgcgtcat 2 111 1 gtaactaaat 0.881808 -137 gccccttcttgtaacaaaatgacaaggttt 2 175 1 gtaacaaaat 0.808833 -73 ttcaccgacggaaactgaaccca 2 235 1 gaaactgaac 0.831023 -13 aagaagtctggcaacgagatggctgactcg 3 48 0 gcaacgagat 0.850727 -253 tgaaagaatggaatggaaattttgattccc 3 119 1 gaatggaaat 0.852538 -182 ttattttttggaatgggaatcaaaatttcc 3 133 0 gaatgggaat 0.902472 -168 tgtcgacaacatgacggaatttatttccac 3 169 0 atgacggaat 0.8459 -132 tagttcaagtgaaacggaaaaaaagaaccc 3 225 1 gaaacggaaa 0.928454 -76 tccgattcgaatgacgaaattaacaatgtg 3 268 0 atgacgaaat 0.774167 -33 ttcgtcattcgaatcggaataatgtacatt 3 280 1 gaatcggaat 0.979287 -21 ********** Masking position 9 Map Score: 11.9582 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 40 Number in noncoding regions = 12 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 ttgctttaattgcgttacttcc 1 3 0 tgcgttactt 0.885573 -51 aattaaactcgtcatcatttcaaatttcgt 2 73 0 gtcatcattt 0.906604 -175 aactaaattttgcgtcatttatggttcaac 2 123 1 tgcgtcattt 0.98927 -125 atttccaccattcgttattttttggaatgg 3 147 0 ttcgttattt 0.968091 -154 ggaaataaattccgtcatgttgtcgacatt 3 171 1 tccgtcatgt 0.939083 -130 ccgtcatgttgtcgacatttaatcaacggg 3 182 1 gtcgacattt 0.939529 -119 cattgttaatttcgtcattcgaatcggaat 3 270 1 ttcgtcattc 0.971607 -31 ********** Masking position 7 Map Score: 4.97928 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 11 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 tacaagaaggggcgattccctgccaagacc 2 158 0 ggcgattccc 0.987153 -90 tttccgtgttgcccatgcccatcttagaaa 2 204 0 gcccatgccc 0.976021 -44 gggcaaccttggcggtgccagaacatcgag 3 22 1 ggcggtgcca 0.96629 -279 gaatcaaaatttccattccattctttcaaa 3 117 0 ttccattcca 0.956719 -184 aaattttgattcccattccaaaaaataacg 3 135 1 tcccattcca 0.988132 -166 tgtacattattccgattcgaatgacgaaat 3 278 0 tccgattcga 0.952719 -23 ********** Masking position 6 Map Score: 3.67202 Number of sites scoring better than the average of aligned sites = 6 Number in coding regions = 5 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ggttcaacgtgtaggtcttggcagggaatcgcccct 2 145 1 gtcttggggg 0.990261 -103 ttgtcattttgttacaagaaggggcgattccctgcc 2 164 0 gtagaaggcg 0.970869 -84 aaatgacaaggtttttctaagatgggcatgggcaac 2 191 1 gtctaagggg 0.998076 -57 caccgccaaggttgcccttagtttgggc 3 3 0 gtcttagtgg 0.98947 -298 tgacggctgtgtgccaagaagtctggcaacgagatg 3 57 0 gtagaagtgg 0.980046 -244 gcacacagccgtcaagctaagacgggctctggtggt 3 79 1 gtctaagggg 0.998076 -222 ** ***** *** Masking position 2 Map Score: 3.64762 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 5 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ttcaacgtgtaggtcttggcagggaatcgc 2 147 1 aggtcttggc 0.965059 -101 gggaatcgccccttcttgtaacaaaatgac 2 168 1 ccttcttgta 0.91107 -80 ttgcccatgcccatcttagaaaaaccttgt 2 196 0 ccatcttaga 0.91107 -52 ggtgaagtttccgtgttgcccatgcccatc 2 211 0 ccgtgttgcc 0.958703 -37 tcgttgccagacttcttggcacacagccgt 3 61 1 acttcttggc 0.981639 -240 ccaccagagcccgtcttagcttgacggctg 3 84 0 ccgtcttagc 0.991767 -217 ********** Masking position 6 Map Score: 1.73296 Number of sites scoring better than the average of aligned sites = 15 Number in coding regions = 15 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 taattatttaaaattaatcgaatttac 1 37 1 aaattaatcg 0.949136 -17 ctggaaaattcaattaaccgtatttaaaca 2 30 0 caattaaccg 0.970679 -218 tttaattgataaattaactggagcggtaac 2 96 1 aaattaactg 0.95801 -152 gcaacacggaaacttcaccgacggaaactg 2 222 1 aacttcaccg 0.957552 -26 tcgaatgacgaaattaacaatgtgcaggtg 3 262 0 aaattaacaa 0.842759 -39 ********** Masking position 5 Map Score: 0.816931 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 53 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 7 aattttccagcatcggaactgagacgaaat 2 50 1 catcggaact 0.944228 -198 gttaatttatcaattaaactcgtcatcatt 2 84 0 caattaaact 0.892256 -164 gcatgggcaacacggaaacttcaccgacgg 2 216 1 cacggaaact 0.991355 -32 aaacttcaccgacggaaactgaaccca 2 231 1 gacggaaact 0.97021 -17 ttttccgtttcacttgaactaacgtttttc 3 216 0 cacttgaact 0.972617 -85 ********** Masking position 7 Map Score: 0.737794 Number of sites scoring better than the average of aligned sites = 29 Number in coding regions = 22 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 8 ********** No masking Map Score: -1.26233e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.26233e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -1.26233e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0