AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i094_mgen_mpneu_300.orf -o094_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMP00575 16 Mycoplasma_pneumoniae Input sequences: #1 RMG00209 112 Mycoplasma #2 RMG02317 20 Mycoplasma #3 RMG02322 24 Mycoplasma #4 RMG02325 35 Mycoplasma #5 RMG02326 90 Mycoplasma #6 RMP00579 300 Mycoplasma_pneumoniae Motif number 1 CAAAACAATGCAAAGTATTTTGGAATAACCAG 1 37 1 CAAAGTTTTG 0.731542 -76 TCTTTTGAGGAAAAGCAGTTATTATCTGGTTA 1 62 0 AAAAGCTTAT 0.68878 -51 TTTTTCACTGTAACTTCTTTTGAGGAAAAGCA 1 77 0 TAACTTTTTG 0.690107 -36 CAACTTAAAATCATTTTTTCACTGTAAC 1 95 0 AAAATCTTTT 0.613714 -18 AATTAATGGAAAAAGTTGCCTTCAAA 4 20 1 AAAAGTCCTT 0.914293 -16 GTGGCAATTTAAAAGTTACTTTAAACACCACC 5 25 1 AAAAGTCTTT 0.94198 -66 GAGCTATGTAAAAATCGGTCTTTTCAAAACAC 5 59 0 AAAATCTCTT 0.806415 -32 tgtaactcaaaaacgtaatttggattgcggta 6 46 0 aaacgttttg 0.770615 -255 ccgaatactgaaactttgttttgatggtcgac 6 174 1 aaactttttt 0.949239 -127 acgttctaaaaaacgtgtttttcgaccgcgtt 6 220 0 aaacgttttt 0.946417 -81 caacttgtgtaaaattcactttaaagaatcca 6 256 1 aaaattcttt 0.92453 -45 caatttattccaaattctcttgttc 6 286 1 caaattcttg 0.858262 -15 ****** **** Masking position 3 Map Score: 10.3423 Number of sites scoring better than the average of aligned sites = 462 Number in coding regions = 418 Number in noncoding regions = 44 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 2 GTTATTATCTGGTTATTCCAAAATACTTTG 1 47 0 GGTTATTCCA 0.988617 -66 AGTTATTCCAATGCCTAATA 3 15 0 AGTTATTCCA 0.987724 -10 TTTGAAGGCAACTTTTTCCATTAATTAAAC 4 16 0 ACTTTTTCCA 0.908189 -20 aaagtgcttgtgttattgcgctatgtcgtg 6 17 0 tgttattgcg 0.882952 -284 tagtgtgtctttttgttcgatggttgacga 6 132 0 ttttgttcga 0.865604 -169 cactaacaacggttgttccgaatactgaaa 6 157 1 ggttgttccg 0.976073 -144 ctaaaaaacgtgtttttcgaccgcgttaag 6 217 0 tgtttttcga 0.938512 -84 aaagaatccaatttattccaaattctcttg 6 278 1 atttattcca 0.956443 -23 ********** Masking position 6 Map Score: 6.01372 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 53 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 TTCCATTAATTAAACACCAC 4 1 0 TAAACACCAC 0.992514 -35 AAAGTTACTTTAAACACCACCTGGTGTTTT 5 36 1 TAAACACCAC 0.992514 -55 CGGTCTTTTCAAAACACCAGGTGGTGTTTA 5 46 0 AAAACACCAG 0.992514 -45 acatagcgcaataacacaagcactttaccg 6 21 1 ataacacaag 0.929615 -280 ********** Masking position 6 Map Score: 3.43124 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 19 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ATGACTGAAGCACTATCCCAAAG 1 3 0 CACATCCCAA 0.985963 -110 TCATTAGCAAAACAATGCAAAGTATTTTGGA 1 30 1 AACATGCAAA 0.941981 -83 AAGACTATGACAATGTGGCAATT 5 3 1 GACATGACAA 0.947562 -88 agcactttaccgcaatccaaattacgttttt 6 39 1 cgcatccaaa 0.968731 -262 ttcgatggttgacgaaccaaaaggttacgta 6 116 0 gacaaccaaa 0.968201 -185 gatctcggtcgaccatcaaaacaaagtttca 6 182 0 gacatcaaaa 0.976582 -119 *** ******* Masking position 5 Map Score: 2.92759 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 38 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.69818e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0