AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i117_mgen_mpneu_100.orf -o117_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02265 300 Mycoplasma #2 RMP00617 275 Mycoplasma_pneumoniae Motif number 1 TATTAGTATCATTTTTTTATAAAAT 1 4 1 TAGTATTTTT 0.918108 -297 TGCTGATGTTCTTGATTATTTTATAAAAAAAT 1 21 0 CTTGATTTTT 0.936031 -280 AACATCAGCACATGATCTTTATCACTAAATTT 1 43 1 CATGATTTAT 0.88105 -258 TCACTAAATTTATGTTTGGTTTCAAATGAAGT 1 64 1 TATGTTGTTT 0.848198 -237 GATTTAGAAGCTGGTTACTTTTGTTTCAGGTA 1 133 1 CTGGTTTTTT 0.958907 -168 CTGAAAAAAACAGGTTCTTTTTTTATTTCTAT 1 194 1 CAGGTTTTTT 0.988228 -107 GTAATGTCTATAGTCTTCTTTTTA 1 287 1 TAGTCTTTTT 0.803895 -14 ccaagttttgtaagatgtttttttgctatgat 2 19 0 taagattttt 0.909361 -257 ctacattggtcaggttgattttcacgtctacc 2 127 0 caggtttttt 0.988228 -149 tgtgaaagcttatgattattttttctttttcc 2 213 0 tatgattttt 0.970596 -63 ****** **** Masking position 6 Map Score: 7.86048 Number of sites scoring better than the average of aligned sites = 235 Number in coding regions = 214 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 2 TATTAGTATCATTTTTTTATAAAATAATCAAG 1 7 1 TATTTTATAA 0.826833 -294 GGATTATAAATCCTGCTTTATTGTAATCATGCTTTA 1 97 1 TCTTTTGTAA 0.993316 -204 TTTTTCAGGTTCTCAGTTTTTTGGAAATGGTACTGG 1 166 0 TCTTTTGGAA 0.972006 -135 AGCAGTAGTTGCGATGTTTATCGTAATGTCTATAGT 1 265 1 GCTTTCGTAA 0.950724 -36 tttgtaacaatcaccaagttttgtaagatgtttttt 2 28 0 tcgtttgtaa 0.986414 -248 tgtcgtaaaatcagcgatttttgtaacaatcaccaa 2 47 0 tcttttgtaa 0.993316 -229 caaaggtgagcctcagtttgtcgtaaaatcagcgat 2 65 0 cctttcgtaa 0.950724 -211 gtttagaaagtccattggtcttataatcgtacgact 2 158 1 tcgtttataa 0.959689 -118 tcataagctttcacaagttcatataagaatttgcaa 2 230 1 tcttatataa 0.884622 -46 ** ** ****** Masking position 9 Map Score: 8.31236 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 35 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 3 GGTACTGGTTACCTGAAACAAAAGTAACCA 1 144 0 ACCTGAAACA 0.975074 -157 AAAACTGAGAACCTGAAAAAAACAGGTTCT 1 182 1 ACCTGAAAAA 0.988615 -119 TTAAGAATATACTTGAACATTTACTAAATA 1 223 0 ACTTGAACAT 0.942627 -78 acatcggtagacgtgaaaatcaacctgacc 2 122 1 acgtgaaaat 0.957552 -154 gtgaaaatcaacctgaccaatgtagtttag 2 134 1 acctgaccaa 0.976868 -142 ********** Masking position 6 Map Score: 3.0551 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 35 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 AGAACATCAGCACATGATCTTTATCACTAAA 1 41 1 CACATGTCTT 0.925643 -260 TGTTTGGTTTCAAATGAAGTTGGATTATAAA 1 76 1 CAAATGAGTT 0.983218 -225 atatttagcgcaaagggacatcggtagacgt 2 105 1 caaaggacat 0.910008 -171 atcaacctgaccaatgtagtttagaaagtcc 2 140 1 ccaatgagtt 0.979828 -136 gattataagaccaatggactttctaaactac 2 155 0 ccaatgactt 0.989354 -121 tgcaaattcttatatgaacttgtgaaagctt 2 234 0 tatatgactt 0.840536 -42 ****** **** Masking position 4 Map Score: 1.05726 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 52 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 GTTTCAAATGAAGTTGGATTATAAATCCTG 1 82 1 AAGTTGGATT 0.969496 -219 GATTACAATAAAGCAGGATTTATAATCCAA 1 95 0 AAGCAGGATT 0.974743 -206 TCTAAATCTAAAGCATGATTACAATAAAGC 1 111 0 AAGCATGATT 0.866444 -190 TTAGATTTAGAAGCTGGTTACTTTTGTTTC 1 130 1 AAGCTGGTTA 0.951873 -171 ********** Masking position 2 Map Score: 1.44807 Number of sites scoring better than the average of aligned sites = 18 Number in coding regions = 15 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 6 ********** No masking Map Score: -1.14154e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.14154e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.14154e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0