AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i117_mgen_mpneu_300.orf -o117_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02265 300 Mycoplasma #2 RMP00617 275 Mycoplasma_pneumoniae Motif number 1 TTATTTTATAAAAAAATGATACTAATA 1 4 0 AAAAAAACTA 0.877795 -297 TCATTTTTTTATAAAATAATCAAGAACATCAGCA 1 19 1 AAAAAACAAG 0.957562 -282 ATAAATTTAGTGATAAAGATCATGTGCTGATGTT 1 43 0 TATAAACATG 0.846809 -258 CAACTTCATTTGAAACCAAACATAAATTTAGTGA 1 64 0 TAAACACATA 0.823514 -237 GTTACCTGAAACAAAAGTAACCAGCTTCTAAATC 1 133 0 AAAAAACCAG 0.977229 -168 AAATAGAAATAAAAAAAGAACCTGTTTTTTTCAG 1 194 0 AAAAAACCTG 0.988059 -107 TAAAAAGAAGACTATAGACATTAC 1 287 0 TAAAAAACTA 0.877795 -14 tgatcatagcaaaaaaacatcttacaaaacttgg 2 17 1 aaaaaactta 0.870226 -259 gcgatttttgtaacaatcaccaagttttgtaaga 2 36 0 tacaaacaag 0.809496 -240 ccctttgcgctaaatattagccaaaggtgagcct 2 88 0 taataaccaa 0.756436 -188 tcggtagacgtgaaaatcaacctgaccaatgtag 2 125 1 taaaaacctg 0.988059 -151 aaggaaaaagaaaaaataatcataagctttcaca 2 211 1 aaaaaacata 0.964515 -65 * **** * **** Masking position 9 Map Score: 9.19106 Number of sites scoring better than the average of aligned sites = 353 Number in coding regions = 325 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 2 TAAAGCATGATTACAATAAAGCAGGATTTATAATC 1 98 0 TTACAAAAGG 0.986702 -203 ATGGTACTGGTTACCTGAAACAAAAGTAACCAGCT 1 141 0 TTACTAAACA 0.925088 -160 CCAGTACCATTTCCAAAAAACTGAGAACCTGAAAA 1 166 1 TTCCAAAACG 0.99162 -135 ACTATAGACATTACGATAAACATCGCAACTACTGC 1 266 0 TTACAAAACG 0.996908 -35 ttggtgattgttacaaaaatcgctgattttacgac 2 47 1 ttacaaatcg 0.987629 -229 atcgctgattttacgacaaactgaggctcaccttt 2 65 1 ttacaaaacg 0.996915 -211 **** * **** * Masking position 8 Map Score: 6.55279 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 11 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 ATAAAATAATCAAGAACATCAGCACATGAT 1 29 1 CAAGAACATC 0.922063 -272 ATTTAGTGATAAAGATCATGTGCTGATGTT 1 43 0 AAAGATCATG 0.817452 -258 ATTTATAATCCAACTTCATTTGAAACCAAA 1 78 0 CAACTTCATT 0.962975 -223 AGTAAATGTTCAAGTATATTCTTAAACGAT 1 228 1 CAAGTATATT 0.888904 -73 tggactttctaaactacattggtcaggttg 2 142 0 aaactacatt 0.925497 -134 tgtagtttagaaagtccattggtcttataa 2 154 1 aaagtccatt 0.94344 -122 taagctttcacaagttcatataagaatttg 2 233 1 caagttcata 0.948808 -43 ********** Masking position 3 Map Score: 1.55962 Number of sites scoring better than the average of aligned sites = 134 Number in coding regions = 126 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 aaatcaacctgaccaatgtagtttagaaag 2 138 1 gaccaatgta 0.973941 -138 acgattataagaccaatggactttctaaac 2 158 0 gaccaatgga 0.982308 -118 tggaccaagagtccagggagtcgtacgatt 2 182 0 gtccagggag 0.969532 -94 tggactcttggtccaaggaaaaagaaaaaa 2 197 1 gtccaaggaa 0.987434 -79 ********** Masking position 5 Map Score: 0.171138 Number of sites scoring better than the average of aligned sites = 10 Number in coding regions = 3 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.14154e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.14154e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.14154e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0