AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i150_mgen_mpneu_100.orf -o150_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG04325 74 Mycoplasma #2 RMG03275 66 Mycoplasma #3 RMP00239 300 Mycoplasma_pneumoniae Motif number 1 GGATGGTAAAGGCAAAAAAACTTGTCTTT 1 9 1 AAGCAAAAAA 0.987706 -66 TGAGTGTAAAAAAGCTAAAAACTAATAAGCT 1 46 0 AAGCTAAAAA 0.994614 -29 GAATTAATAGAAATCTTAAAACATATAATAA 2 18 1 AATCTTAAAA 0.91244 -49 aaccacgcttaacgctacaaacggaaagg 3 9 0 aagctacaaa 0.982706 -292 tgttttgataaatgcttaaacttttcaaaaa 3 62 0 aagcttaaac 0.981838 -239 tatttttcccattgctaaaaatagtgatatc 3 218 1 atgctaaaaa 0.987701 -83 ttggaatatcattgcaaaaacctgatttcca 3 265 1 atgcaaaaac 0.959202 -36 ** ******** Masking position 9 Map Score: 10.2908 Number of sites scoring better than the average of aligned sites = 119 Number in coding regions = 109 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 2 ATATTGTTAATAAAATTATTATATGTTTTA 2 34 0 TAAAATTATT 0.967551 -33 ATTAAATAGAAAAATATTGTTAATAAAA 2 49 0 GAAAAATATT 0.930323 -18 ggcaatcacatgaaaatattgcggtcttat 3 172 0 tgaaaatatt 0.962019 -129 aaaataacgttgaaattattgtggcaatca 3 194 0 tgaaattatt 0.979266 -107 ctaaaaatagtgatatcatttgcatggcta 3 232 1 tgatatcatt 0.954543 -69 gctacctttggaatatcattgcaaaaacct 3 258 1 gaatatcatt 0.917158 -43 ********** Masking position 5 Map Score: 5.03526 Number of sites scoring better than the average of aligned sites = 141 Number in coding regions = 131 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 TAGTTTTTAGCTTTTTTACACTCAGCTTATT 1 53 1 CTTTTTACAC 0.876091 -22 ATATAATAATTTTATTAACAATATTTTTCTA 2 40 1 TTTATAACAA 0.925664 -27 gcgtggttggtttattaaaactaggggactt 3 32 1 tttataaaac 0.920572 -269 aatgcttaaacttttcaaaaaagtcccctag 3 52 0 cttttaaaaa 0.615833 -249 agtttaagcatttatcaaaacaacgagttac 3 71 1 tttataaaac 0.920572 -230 atattgcggtcttataaaaaaggcgagcaat 3 156 0 cttataaaaa 0.920572 -145 ***** ***** Masking position 5 Map Score: 4.15014 Number of sites scoring better than the average of aligned sites = 117 Number in coding regions = 110 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 cgagcaatacgggaatcaggtacagcaaata 3 133 0 ggaatcaggt 0.998121 -168 aaattattgtggcaatcacatgaaaatattg 3 181 0 ggaatcacat 0.990637 -120 tattgagcttggaaatcaggtttttgcaatg 3 274 0 ggaatcaggt 0.998121 -27 ** ******** Masking position 5 Map Score: 1.96614 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ATTTTATTAACAATATTTTTCTATTTAAT 2 48 1 CAATATTTTT 0.822561 -19 taaaactaggggacttttttgaaaagttta 3 47 1 ggactttttt 0.898116 -254 aacgagttacggttttctttggttcctttt 3 92 1 ggttttcttt 0.926638 -209 ggttttctttggttccttttttgtggcacg 3 102 1 ggttcctttt 0.881082 -199 ccgtattgctcgccttttttataagaccgc 3 152 1 cgcctttttt 0.952065 -149 ataatttcaacgttatttttcccattgcta 3 205 1 cgttattttt 0.966716 -96 caaatgatatcactatttttagcaatggga 3 224 0 cactattttt 0.912633 -77 tcatttgcatggctacctttggaatatcat 3 247 1 ggctaccttt 0.936081 -54 ********** Masking position 8 Map Score: 2.58533 Number of sites scoring better than the average of aligned sites = 284 Number in coding regions = 256 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 6 ********** No masking Map Score: 1.01908e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.01908e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.01908e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0