AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i190_mgen_mpneu_300.orf -o190_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG00426 270 Mycoplasma #2 RMG01505 45 Mycoplasma #3 RMG02531 69 Mycoplasma #4 RMG00446 18 Mycoplasma #5 RMP00513 23 Mycoplasma_pneumoniae #6 RMP00517 300 Mycoplasma_pneumoniae Motif number 1 TTTAGATGTGATTAATAGACAAAAGGAGTTAT 1 10 0 ATATAGCAAA 0.951667 -261 CAGTTATTTAACTGATAGGCAAATAAAGTTAAT 1 153 0 ATATAGCAAA 0.951669 -118 GGTTAATTTAAGTTGTAGTCATTTCATTTTGGA 1 219 1 ATGTAGCATT 0.745371 -52 GTAGTCATTTCATTTTGGACAAAAAGAAATTTT 1 233 1 CTTTGGCAAA 0.958621 -38 caaatagagaattggtggccaaacttatcaatt 6 45 1 atgtggcaaa 0.983752 -256 atattctgtgatttttcggcaaaatcgtcgagt 6 79 0 atttcgcaaa 0.988313 -222 aaaatcacagaatattcgcgaatctttcggaaa 6 97 1 atttcggaat 0.939126 -204 aaaacccccgaatgttcgccaataattgtaaca 6 177 1 atttcgcaat 0.979675 -124 ttttgttacaattattggacaattttgttacaa 6 202 0 atttggcaat 0.986252 -99 aaaacgtcacaattttggcgaaatttcgaatat 6 255 1 atttgggaaa 0.96743 -46 * * **** **** Masking position 6 Map Score: 12.2035 Number of sites scoring better than the average of aligned sites = 44 Number in coding regions = 40 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 2 ATCTAAATCTAAAAGTGCCAAAGTTTTATAAT 1 36 1 AAAAGCCAAA 0.975981 -235 GATAAACTACAAAACAATAAAAAAGCCTACCA 1 184 0 AAAAATAAAA 0.92537 -87 AATGTTTATTAAAAAAACAAAATAAAAAGCGG 3 11 1 AAAAACAAAA 0.92061 -59 gcgacttacgaaaaacataaaaaacagaatac 6 14 0 aaaaataaaa 0.92537 -287 atttttcggcaaaatcgtcgagttaattgata 6 70 0 aaaagtcgag 0.928819 -231 attttgccgaaaaatcacagaatattcgcgaa 6 87 1 aaaaacagaa 0.948697 -214 aagacacggtaaaaggatcgaactcggatttt 6 129 1 aaaaatcgaa 0.981758 -172 gatgtccggcaaaacccccgaatgttcgccaa 6 167 1 aaaacccgaa 0.948464 -134 taattgtaacaaaattgtccaataattgtaac 6 199 1 aaaagtccaa 0.940784 -102 gtaatcgagtaaaaacgtcacaattttggcga 6 244 1 aaaagtcaca 0.891097 -57 atttgcggaaaaaaatttcgaaatattcgaaa 6 278 0 aaaattcgaa 0.92996 -23 **** ****** Masking position 4 Map Score: 11.4181 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 152 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 TAATCACATCTAAATCTAAAAGTGCCAAAG 1 29 1 TAAATCTAAA 0.886337 -242 GACAGTTGATCAATTATAAAACTTTGGCAC 1 50 0 CAATTATAAA 0.932206 -221 CTTAAGATAGCAATTCTAAACGATAAATTA 2 17 0 CAATTCTAAA 0.955096 -29 AGTGGATAACTATAAATA 4 3 0 TAACTATAAA 0.88196 -16 tgttcgccaataattgtaacaaaattgtcc 6 189 1 taattgtaac 0.955096 -112 aattgtccaataattgtaacaaaattttcc 6 211 1 taattgtaac 0.955096 -90 ********** Masking position 5 Map Score: 2.04599 Number of sites scoring better than the average of aligned sites = 21 Number in coding regions = 12 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 4 GATTAATAGACAAAAGGAGTTAT 1 1 0 CAAAAGATTT 0.916175 -270 TCTTTTTGTCCAAAATGAAATGACTACAACTTA 1 227 0 CAAAAGAATA 0.916174 -44 TCATTTTGGACAAAAAGAAATTTTTATGCTAAG 1 242 1 CAAAAGAATT 0.981359 -29 GATAGCAATTCTAAACGATAAATTAAATTAA 2 9 0 CTAAAGAAAT 0.981359 -37 TATAACCTGTCTAAAAGACAATTTC 3 55 1 CTAAAGAAAT 0.981359 -15 tcgtaagtcgcaaatagagaattggtggccaaa 6 35 1 caaatgaaat 0.967556 -266 aatcgtcgagttaattgataagtttggccacca 6 57 0 ttaatgaaat 0.748155 -244 ***** ** ** * Masking position 8 Map Score: 3.82595 Number of sites scoring better than the average of aligned sites = 60 Number in coding regions = 53 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 5 gcaaaatcgtcgagttaattgataagtttgg 6 63 0 cgagtaattg 0.950046 -238 cgaaaaatcacagaatattcgcgaatctttc 6 94 1 cagatattcg 0.88685 -207 gtgtcttttccgaaagattcgcgaatattct 6 105 0 cgaagattcg 0.628357 -196 ggcgaacattcgggggttttgccggacatcc 6 166 0 cggggttttg 0.871181 -135 caaaattttccgaggtaatcgagtaaaaacg 6 230 1 cgagtaatcg 0.982375 -71 aaaaaaatttcgaaatattcgaaatttcgcc 6 271 0 cgaatattcg 0.629704 -30 **** ****** Masking position 9 Map Score: 1.69623 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 2 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ACAGAGTATCAGCTTGCGGAGCTGAGGGTT 1 96 1 AGCTTGCGGA 0.981151 -175 taactcgacgattttgccgaaaaatcacag 6 77 1 attttgccga 0.990744 -224 atattcgcgaatctttcggaaaagacacgg 6 108 1 atctttcgga 0.967727 -193 attgtaacaaaattttccgaggtaatcgag 6 223 1 aattttccga 0.961893 -78 aaacgtcacaattttggcgaaatttcgaat 6 256 1 attttggcga 0.960851 -45 aatttgcggaaaaaaatttc 6 291 0 aatttgcgga 0.98679 -10 ********** Masking position 5 Map Score: 6.56908 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 2 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 7 ********** No masking Map Score: 1.10377e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.10377e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: 1.10377e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0