AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i192_mgen_mpneu_300.orf -o192_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02485 300 Mycoplasma #2 RMG00374 127 Mycoplasma #3 RMP00033 125 Mycoplasma_pneumoniae #4 RMP00035 22 Mycoplasma_pneumoniae #5 RMP00036 300 Mycoplasma_pneumoniae Motif number 1 AAACTTCATAATGGCATTGATGTCTATCTCCCCATCT 1 11 0 ATGGTTGGAT 0.804411 -290 CTAAGAACTGTTGAACTTGGGGGTTAGTGGTGAGTTT 1 126 0 TTGATTGGAG 0.829736 -175 CTTTAAGCTCTTGATGTTGTCTTGCAACAGTTCATAT 1 179 0 TTGATTGTAA 0.837422 -122 AGAGGTATTGATAGCTTTGTTGATCAAGTGGCTTTTT 1 243 0 ATAGTTGGAA 0.940731 -58 TATAAAACTTTAAGTGGTGCCGAATAACAGAGTCGAA 2 14 1 TAAGGTGGAA 0.973309 -114 TGCTGCCGAATTGGTTTAGGGGCAAAACAGATCCATG 2 69 0 TTGGTAGGAA 0.905489 -59 AAAATTGAAATTAGCTTTGCTGCCGAATTGGTTTAGG 2 86 0 TTAGTTGGAA 0.987296 -42 CTAAAGTTTGAATTTAAAATTGAAATTA 2 110 0 TAAATTGTAA 0.739699 -18 gctgagacaataagccgtggttaataattataaagga 3 12 0 taaggtgtaa 0.878935 -114 taacgaagcttagggggtgtggttaaaccacctcaca 5 102 1 tagggtggaa 0.976875 -199 acaggaatacttaattttgtcgtgaatgtcgttaagg 5 147 1 ttaattggat 0.833481 -154 gggaacggtctaagtagtgacggttaatccatttcac 5 197 1 taaggtggaa 0.972245 -104 acgttgtgcgtttgtgttggcgtgaaatggattaacc 5 218 0 tttgttggaa 0.93301 -83 **** *** * ** Masking position 16 Map Score: 9.4143 Number of sites scoring better than the average of aligned sites = 221 Number in coding regions = 203 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 AGATAGACATCAATGCCATTATGAAGTTTGAAAAA 1 19 1 CAAGCTTTAA 0.978854 -282 GTTTGAAAAACTAGGCATTGCTAAAACCAAGCGCA 1 44 1 CTAGCTGTAA 0.98959 -257 TGTAAAAGTTCTAAGAACTGTTGAACTTGGGGGTT 1 138 0 CTAGATGTAA 0.925346 -163 TTGGGGATAACTAGGTTATTTTTAAAGTACTTTAA 1 210 0 CTAGTTTTAA 0.966579 -91 AATTCGGCAGCAAAGCTAATTTCAATTTTAAATTC 2 94 1 CAAGCATTAA 0.89242 -34 agctgagacaataagccgtggttaataattataaa 3 15 0 atagctgtaa 0.893032 -111 ggtaccattcctagtctcttgtcaagctgagacaa 3 39 0 ctatctttaa 0.885184 -87 ttgattaagccgaagttcctattaagatcaaattt 3 90 1 cgagtcttaa 0.813079 -36 agtactggttcaatgtaattcgcaactacgatttt 5 18 0 caagtttgaa 0.759838 -283 accacaccccctaagcttcgttaaattgctaatgg 5 90 0 ctagccgtaa 0.979043 -211 *** ** ** * ** Masking position 3 Map Score: 5.05601 Number of sites scoring better than the average of aligned sites = 56 Number in coding regions = 52 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 ACTTTAAGCTCTTGATGTTGTCTTGCAACAG 1 186 0 CTTGATGTTT 0.973221 -115 ACATCAAGAGCTTAAAGTACTTTAAAAATAA 1 199 1 CTTAAAGTAT 0.944758 -102 TTCGGCACCACTTAAAGTTTTATATAA 2 7 0 CTTAAAGTTT 0.982547 -121 aatcttaatgttatttaatgag 4 4 1 cttaatgttt 0.987733 -19 aacaggaatacttaattttgtcgtgaatgtc 5 146 1 cttaattttt 0.939222 -155 ********* * Masking position 5 Map Score: 3.11721 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 21 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 TGAACTGTTGCAAGACAACATCAAGAGCTT 1 182 1 CAAGACAACA 0.983729 -119 attgtctcagcttgacaagagactaggaat 3 38 1 cttgacaaga 0.928582 -88 ggaatggtacctagacaaaacggggatttg 3 63 1 ctagacaaaa 0.964636 -63 taacgacattcacgacaaaattaagtattc 5 151 0 cacgacaaaa 0.983729 -150 taatccatttcacgccaacacaaacgcaca 5 221 1 cacgccaaca 0.976814 -80 ********** Masking position 7 Map Score: 2.40504 Number of sites scoring better than the average of aligned sites = 23 Number in coding regions = 19 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 GTTAGTGGTGAGTTTCTTTTTAGGGACACT 1 111 0 AGTTTCTTTT 0.868911 -190 GTCTTGCAACAGTTCATATTCAGCTTGTAA 1 168 0 AGTTCATATT 0.882971 -133 AGAACCCATTAGTTAGAATTTGTTAAT 1 284 1 AGTTAGAATT 0.827086 -17 CAGCAAAGCTAATTTCAATTTTAAATTCAA 2 101 1 AATTTCAATT 0.692329 -27 CTAAAGTTTGAATTTAAAATTGAA 2 114 0 AGTTTGAATT 0.90767 -14 attaagccgaagttcctattaagatcaaat 3 93 1 agttcctatt 0.923985 -33 gaggcaggtttaaatttgatcttaat 3 110 0 ggtttaaatt 0.910141 -16 aattgctaatggtttaatttcgaaatcacg 5 72 0 ggtttaattt 0.792856 -229 ********** Masking position 4 Map Score: 2.02129 Number of sites scoring better than the average of aligned sites = 137 Number in coding regions = 122 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 6 AAAACCAAGCGCAAGGGCGATCTTTTTGTCC 1 66 1 GCAAGGCGAT 0.844169 -235 AAAACTTTAAGTGGTGCCGAATAACAGAGTC 2 17 1 GTGGTGCGAA 0.98582 -111 attcaaaatcgtagttgcgaattacattgaa 5 14 1 gtagttcgaa 0.955392 -287 actaaaatccgtgatttcgaaattaaaccat 5 63 1 gtgattcgaa 0.923477 -238 tgtcgttaaggcggtttcgatagtgggaacg 5 173 1 gcggttcgat 0.974848 -128 ggtttcgatagtgggaacggtctaagtagtg 5 185 1 gtgggacggt 0.911604 -116 aacggtctaagtagtgacggttaatccattt 5 200 1 gtagtgcggt 0.967217 -101 ****** **** Masking position 8 Map Score: 1.6703 Number of sites scoring better than the average of aligned sites = 12 Number in coding regions = 4 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 7 CCTTGCGCTTGGTTTTAGCAATGCCTAGTT 1 52 0 GGTTTTAGCA 0.744989 -249 TGGTGAGTTTCTTTTTAGGGACACTACTGT 1 106 0 CTTTTTAGGG 0.903028 -195 AAGAACTGTTGAACTTGGGGGTTAGTGGTG 1 131 0 GAACTTGGGG 0.90607 -170 AAGTTCAACAGTTCTTAGAACTTTTACAAG 1 145 1 GTTCTTAGAA 0.716282 -156 GATCAAGTGGCTTTTTGGGGATAACTAGGT 1 229 0 CTTTTTGGGG 0.959715 -72 TAACTAATGGGTTCTTGGGAGAGGTATTGA 1 269 0 GTTCTTGGGA 0.976608 -32 CTGCCGAATTGGTTTAGGGGCAAAACAGAT 2 74 0 GGTTTAGGGG 0.89035 -54 cattgaaccagtacttggcgacggaactaa 5 38 1 gtacttggcg 0.942853 -263 ********** Masking position 5 Map Score: 0.544891 Number of sites scoring better than the average of aligned sites = 142 Number in coding regions = 126 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 8 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -4.38104e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0