AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i193_mgen_mpneu_100.orf -o193_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02591 234 Mycoplasma #2 RMP00460 300 Mycoplasma_pneumoniae Motif number 1 TAATAGAGATTTTTTTGTTATTAACAATTT 1 13 0 TTTTTTGTTA 0.959554 -222 TAAAGTTGGTTTTTTTAATAGAGATTTTTT 1 28 0 TTTTTTAATA 0.966197 -207 ATTAATAAAATTTATTAATATATGCGCCCA 1 149 0 TTTATTAATA 0.900426 -86 ATTAATAAATTTTATTAATATAAGCAAGAA 1 160 1 TTTATTAATA 0.900426 -75 AATTAGATTGTTCTTGCTTATATTAATAAA 1 170 0 TTCTTGCTTA 0.820535 -65 AACAATCTAATTCTTTATTAGAATTTAAAC 1 188 1 TTCTTTATTA 0.966756 -47 gtttcctattttttttattccaacttgtcg 2 87 1 ttttttattc 0.945155 -214 tctactgtagttctttgatcttctcaactt 2 184 1 ttctttgatc 0.885896 -117 tcttctcaacttttttcttaaccttttgtg 2 202 1 ttttttctta 0.959554 -99 ********** Masking position 5 Map Score: 9.79976 Number of sites scoring better than the average of aligned sites = 256 Number in coding regions = 219 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 2 TTCGGACCAGAAGGTTATGGGTTCAAGTCC 1 93 0 AAGGTTATGG 0.952923 -142 ggttaagaaaaaagttgagaagatcaaaga 2 195 0 aaagttgaga 0.986078 -106 gtttccacaaaaggttaagaaaaaagttga 2 207 0 aaggttaaga 0.993281 -94 agtgcaaattaaagttaagaccatgcaccg 2 238 0 aaagttaaga 0.984988 -63 aatcaaatgcaaggttgagaaactaaagtg 2 264 0 aaggttgaga 0.993773 -37 ********** Masking position 5 Map Score: 8.44388 Number of sites scoring better than the average of aligned sites = 7 Number in coding regions = 5 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 GCGCGCCCAATAGGACTTGAACCCATAACCTT 1 81 1 TGACTTGAAC 0.988865 -154 AATTCTTTATTAGAATTTAAACGATTTCATCT 1 196 1 TAATTTAAAC 0.934106 -39 ATGTGATTTGAACTATTAGATGA 1 222 0 TGATTTGAAC 0.986585 -13 ttccaacttgtcgaacttggtcatctggaaaa 2 104 1 taacttggtc 0.954531 -197 caagttgtagtaaattttgaacccacaggaga 2 151 0 tattttgaac 0.957787 -150 caaaatttactacaacttgatctactgtagtt 2 164 1 taacttgatc 0.982881 -137 tggtcttaactttaatttgcactttagtttct 2 245 1 taatttgcac 0.975586 -56 * ********* Masking position 7 Map Score: 5.86045 Number of sites scoring better than the average of aligned sites = 49 Number in coding regions = 41 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 4 ACCAACTTTAAAGTTGGTTTTTTTAATAGA 1 36 0 AAGTTGGTTT 0.988846 -199 ACCAACTTTAAAGTTGGTTTGAAATTCTAA 1 48 1 AAGTTGGTTT 0.988846 -187 taatcgactgaagttgtgtcagcgagatta 2 51 1 aagttgtgtc 0.937117 -250 caagttcgacaagttggaataaaaaaaata 2 93 0 aagttggaat 0.972297 -208 acagtagatcaagttgtagtaaattttgaa 2 162 0 aagttgtagt 0.958484 -139 ********** Masking position 5 Map Score: 3.67384 Number of sites scoring better than the average of aligned sites = 40 Number in coding regions = 32 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 5 TTCTAAATGGCGCGCCCAATAGGACTTGAA 1 72 1 CGCGCCCAAT 0.939747 -163 CAATAGGACTTGAACCCATAACCTTCTGGT 1 88 1 TGAACCCATA 0.979372 -147 CCTTCTGGTCCGAAGCCAGACACTCTATCC 1 109 1 CGAAGCCAGA 0.933157 -126 TATTAATATATGCGCCCATAGCTCAATCGG 1 137 0 TGCGCCCATA 0.984068 -98 tagtaaattttgaacccacaggagatcgaa 2 146 0 tgaacccaca 0.975517 -155 gttaagaccatgcaccgagtttccacaaaa 2 225 0 tgcaccgagt 0.934176 -76 ********** Masking position 8 Map Score: 1.91677 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 14 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 CTTGAACCCATAACCTTCTGGTCCGAAGCC 1 96 1 TAACCTTCTG 0.952204 -139 gaaataattttaatcgactgaagttgtgtc 2 41 1 taatcgactg 0.942423 -260 ttgtcgaacttggtcatctggaaaaactcg 2 111 1 tggtcatctg 0.94714 -190 tcgcctgattcgatctcctgtgggttcaaa 2 138 1 cgatctcctg 0.971892 -163 tactacaacttgatctactgtagttctttg 2 171 1 tgatctactg 0.991188 -130 tgtagttctttgatcttctcaacttttttc 2 189 1 tgatcttctc 0.973665 -112 ********** Masking position 9 Map Score: 2.7541 Number of sites scoring better than the average of aligned sites = 37 Number in coding regions = 35 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 7 TTAAATTGTTAATAACAAAA 1 1 1 TTAAATTGTT 0.668837 -234 GGTTTTTTTAATAGAGATTTTTTTGTTATT 1 21 0 ATAGAGATTT 0.612396 -214 GGCGCGCCATTTAGAATTTCAAACCAACTT 1 58 0 TTAGAATTTC 0.917615 -177 GCTCAATCGGATAGAGTGTCTGGCTTCGGA 1 117 0 ATAGAGTGTC 0.925761 -118 TAATAAAGAATTAGATTGTTCTTGCTTATA 1 178 0 TTAGATTGTT 0.953707 -57 TAATTCTTTATTAGAATTTAAACGATTTCA 1 195 1 TTAGAATTTA 0.680951 -40 aagataatttagagactcttgacgcgtt 2 9 1 ttagagactc 0.925761 -292 aatttgcactttagtttctcaaccttgcat 2 258 1 ttagtttctc 0.837434 -43 caaccttgcatttgattcttccttggcaat 2 277 1 tttgattctt 0.764578 -24 ********** Masking position 2 Map Score: 0.490151 Number of sites scoring better than the average of aligned sites = 152 Number in coding regions = 128 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 8 ********** No masking Map Score: -1.39676e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.39676e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -1.39676e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0