AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i196_mgen_mpneu_300.orf -o196_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMP00575 16 Mycoplasma_pneumoniae Input sequences: #1 RMG00209 112 Mycoplasma #2 RMG02317 20 Mycoplasma #3 RMG02322 24 Mycoplasma #4 RMG02325 35 Mycoplasma #5 RMG02326 90 Mycoplasma #6 RMG01300 57 Mycoplasma #7 RMP00573 36 Mycoplasma_pneumoniae #8 RMP00579 300 Mycoplasma_pneumoniae Motif number 1 ATCTGGTTATTCCAAAATACTTTGCATTGTTTTGC 1 36 0 TCAAAATTGC 0.917907 -77 CAACTTAAAATCATTTTTTCACTGTAACT 1 94 0 TTAAAATTTT 0.978442 -19 TTTGAAGGCAACTTTTTCCATTAATT 4 20 0 TTAAGATTTT 0.900129 -16 CCAGGTGGTGTTTAAAGTAACTTTTAAATTGCCAC 5 25 0 TTAAAATTTT 0.979533 -66 CAGAGCTATGTAAAAATCGGTCTTTTCAAAACACC 5 58 0 TAAAAGCTTT 0.831295 -33 CTTACTTAACTATAAATAAGGTTTTTGT 6 4 0 TAAAAATTTT 0.973513 -54 tttaccgcaatccaaattacgtttttgagttacaa 8 44 1 tcaaaatttt 0.986996 -257 cggtcgaccatcaaaacaaagtttcagtattcgga 8 173 0 tcaaaatttc 0.966809 -128 acaaacgttctaaaaaacgtgtttttcgaccgcgt 8 221 0 taaaagtttt 0.963157 -80 aattggattctttaaagtgaattttacacaagttg 8 256 0 ttaaagtttt 0.971491 -45 tccaatttattccaaattctcttgttc 8 284 1 tcaaacttgt 0.885546 -17 ** *** * **** Masking position 5 Map Score: 11.5695 Number of sites scoring better than the average of aligned sites = 319 Number in coding regions = 288 Number in noncoding regions = 31 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 2 GTTATTATCTGGTTATTCCAAAATACTTTG 1 47 0 GGTTATTCCA 0.980488 -66 AGTTATTCCAATGCCTAATA 3 15 0 AGTTATTCCA 0.978971 -10 TTTGAAGGCAACTTTTTCCATTAATTAAAC 4 16 0 ACTTTTTCCA 0.89132 -20 gatattgatatttatttccaattg 7 5 0 tttatttcca 0.741596 -32 aaagtgcttgtgttattgcgctatgtcgtg 8 17 0 tgttattgcg 0.811565 -284 tagtgtgtctttttgttcgatggttgacga 8 132 0 ttttgttcga 0.85686 -169 cactaacaacggttgttccgaatactgaaa 8 157 1 ggttgttccg 0.953216 -144 ctaaaaaacgtgtttttcgaccgcgttaag 8 217 0 tgtttttcga 0.93415 -84 aaagaatccaatttattccaaattctcttg 8 278 1 atttattcca 0.947932 -23 ********** Masking position 6 Map Score: 5.21916 Number of sites scoring better than the average of aligned sites = 139 Number in coding regions = 128 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 3 CAGTTATTATCTGGTTATTCCAAAATACTT 1 49 0 CTGGTTATTC 0.897914 -64 GTGGTGTTTAATTAATGGAA 4 1 1 GTGGTGTTTA 0.980374 -35 AAAACACCAGGTGGTGTTTAAAGTAACTTT 5 36 0 GTGGTGTTTA 0.980374 -55 TAAACACCACCTGGTGTTTTGAAAAGACCG 5 46 1 CTGGTGTTTT 0.985229 -45 CACCAGGTTTTTAATCATTAATA 6 45 0 CAGGTTTTTA 0.970217 -13 ggtcgaaaaacacgttttttagaacgtttg 8 225 1 cacgtttttt 0.83904 -76 ********** Masking position 5 Map Score: 3.55874 Number of sites scoring better than the average of aligned sites = 121 Number in coding regions = 108 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 TTTTCCTCAAAAGAAGTTACAGTGAAAAAA 1 80 1 AAGAAGTTAC 0.968522 -33 TAATTAATGGAAAAAGTTGCCTTCAAA 4 19 1 AAAAAGTTGC 0.968521 -17 TGTGGCAATTTAAAAGTTACTTTAAACACC 5 24 1 TAAAAGTTAC 0.978306 -67 ttgacgaaccaaaaggttacgtagtcctgg 8 109 0 aaaaggttac 0.968525 -192 accatcgaacaaaaagacacactaacaacg 8 138 1 aaaaagacac 0.945093 -163 tcaacttgtgtaaaattcactttaaagaat 8 255 1 taaaattcac 0.85259 -46 ********** Masking position 4 Map Score: 3.71565 Number of sites scoring better than the average of aligned sites = 71 Number in coding regions = 66 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ACTTTGCATTGTTTTGCTAATGACTGAAGCAC 1 21 0 GTTTCTAATG 0.977427 -92 GTGGTGTTTAATTAATGGAAAAAGTTG 4 6 1 GTTTTTAATG 0.8805 -30 TAAGTAAGTaGTTTTATTAATGATTAAAAACC 6 31 1 GTTTTTAATG 0.983194 -27 cgaccgagatctttgcttaacgcggtcgaaaa 8 202 1 ctttttaacg 0.94685 -99 gaataaattggattctttaaagtgaattttac 8 264 0 gattttaaag 0.928136 -37 **** ****** Masking position 8 Map Score: 1.79228 Number of sites scoring better than the average of aligned sites = 59 Number in coding regions = 57 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 CTTTGGGATAGTGCTTCAGTCATTAG 1 5 1 GGATAGTGTT 0.986758 -108 AGCAAAACAATGCAAAGTATTTTGGAATAACC 1 35 1 TGAAAGTATT 0.940439 -78 CTTCTTTTGAGGAAAAGCAGTTATTATCTGGT 1 64 0 GGAAAGCATT 0.973904 -49 AAGTTACAGTGAAAAAATGATTTTAAGTTG 1 93 1 GAAAAATGTT 0.89954 -20 AATCAACTGCAAAAGTGTTT 2 9 1 GCAAAGTGTT 0.988477 -12 tttggattgcggtaaagtgcttgtgttattgc 8 28 0 ggaaagtgtt 0.9967 -273 ** ****** ** Masking position 6 Map Score: 3.17701 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 67 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 7 ********** No masking Map Score: -1.31207e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.31207e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -1.31207e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0