AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i198_mgen_mpneu_100.orf -o198_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG03275 66 Mycoplasma #2 RMP00237 54 Mycoplasma_pneumoniae Motif number 1 ATGTTTTAAGATTTCTATTAATTCAAGTAAT 1 11 0 ATTTTATTAA 0.991248 -56 TAAAATTATTATATGTTTTAAGATTTCTATT 1 23 0 ATATTTTTAA 0.947524 -44 AACATATAATAATTTTATTAACAATATTTTT 1 37 1 AATTTATTAA 0.988632 -30 TTAACAATATTTTTCTATTTAAT 1 54 1 TTTTTATTTA 0.942558 -13 ttcctaaatttattggtcaatataat 2 6 1 aaattattgg 0.956874 -49 tatttacttaaattatattgaccaataaatt 2 17 0 aatttattga 0.989462 -38 cttctaactaatatttacttaaattatattg 2 28 0 atattactta 0.949125 -27 **** ****** Masking position 6 Map Score: 9.34958 Number of sites scoring better than the average of aligned sites = 164 Number in coding regions = 127 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 2 AGATTTCTATTAATTCAAGTAAT 1 4 0 TAATTCAAGT 0.984322 -63 AATTATTATATGTTTTAAGATTTCTATTAA 1 21 0 TGTTTTAAGA 0.892003 -46 AAACATATAATAATTTTATTAACAATATTT 1 36 1 TAATTTTATT 0.934384 -31 attgaccaataaatttaggaa 2 2 0 aaatttagga 0.947464 -53 ttggtcaatataatttaagtaaatattagt 2 23 1 taatttaagt 0.994126 -32 taatttaagtaaatattagttagaagcgtc 2 33 1 aaatattagt 0.924026 -22 ********** Masking position 4 Map Score: 5.33873 Number of sites scoring better than the average of aligned sites = 344 Number in coding regions = 298 Number in noncoding regions = 46 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0