AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i210_mgen_mpneu_100.orf -o210_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RMP00323 42 Mycoplasma_pneumoniae Input sequences: #1 RMG00273 137 Mycoplasma #2 RMG02389 24 Mycoplasma #3 RMG04418 88 Mycoplasma #4 RMG03260 188 Mycoplasma #5 RMP00221 157 Mycoplasma_pneumoniae #6 RMP00677 300 Mycoplasma_pneumoniae Motif number 1 AGTGCTTAATTTAAATTATTAGTAGTGAATC 1 48 0 TAAATTATTA 0.8564 -90 TCTAAAGGGATTAATATATTAGTATGAGTGC 1 74 0 TAATATATTA 0.85622 -64 TAAATCAGAGTAATTTTATTAATATTTATCT 3 23 0 TATTTTATTA 0.911383 -66 AATGGCTTTGTTAATTTGTTTAGATGTATAG 4 17 1 TAATTTGTTT 0.814339 -172 ATATAGTTTTTATTTTTATTAATAAATTCTC 4 70 0 TTTTTTATTA 0.921963 -119 AAATAAAAACTATATTTATTATAAGTAATAA 4 86 1 TTATTTATTA 0.962898 -103 AGTAAGTAGGAGAATTTATTACTTCTAACCT 4 116 1 AAATTTATTA 0.856591 -73 AGCCGTTTTCTAATTTTGTTATAATTCAACG 4 155 1 TATTTTGTTA 0.94613 -34 ATTCAACGTGTTTATTAATTA 4 178 1 TTATTAATTA 0.841446 -11 ttattagtaattaattagttaacagcccact 5 26 1 taattagtta 0.893795 -132 gttgttttggtttatttattataagtttggg 5 64 1 ttatttatta 0.962942 -94 ggctaatttcttattttgttataattcaaca 5 126 1 tattttgtta 0.950106 -32 ttcgtcgatgtgaatttattatgggggctgg 6 169 0 taatttatta 0.98245 -132 * ********* Masking position 9 Map Score: 18.7916 Number of sites scoring better than the average of aligned sites = 110 Number in coding regions = 90 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 2 ACTCTTTAAAACTTCCCTTTATAATCAAATATCGC 1 112 1 ACTCTTTAAT 0.598011 -26 AAATCAGAGTAATTTTATTAATATTTATCTAACTT 3 18 0 AATTTATATT 0.761549 -71 AGGCATTAACAATGTCTTTTTTAAGTCCATTAAAT 3 49 0 AATTTTTAAG 0.794927 -40 AAGTTAAATGGCTTTGTTAATTTGTTTAGAT 4 7 1 AATGTGTAAT 0.93588 -182 TTTATTAATAAATTCTCTCGATATTTTCGATATTT 4 52 0 AATCTGTATT 0.924742 -137 ACTTATAATAAATATAGTTTTTATTTTTATTAATA 4 77 0 AATTTTTATT 0.906349 -112 agatgactttgatagttattagtaattaat 5 6 1 actttgtatt 0.91208 -152 acactttaccaatctaattgctgatctctagcagt 6 18 0 aatttgtgat 0.965428 -283 agaacattttaatctcgtagttgatgcccacctaa 6 117 1 aatttgtgat 0.965435 -184 tgcccacctaaatcgcgtttgtgatggtccagccc 6 141 1 aatgtttgat 0.775653 -160 gcgaggtcaaaatttcgtcgatgtgaatttattat 6 178 0 aatttgtgtg 0.883949 -123 atttcgtgacaatgtttttgcgaatttccattcga 6 222 1 aatttggaat 0.857123 -79 agggaaaggaaatttgttcgttattacactagatc 6 271 0 aatttgtatt 0.970432 -30 *** * * * **** Masking position 1 Map Score: 8.58039 Number of sites scoring better than the average of aligned sites = 215 Number in coding regions = 194 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 AATTTAAATTAAGCACTCATACTAATATATT 1 62 1 AAGCACCATA 0.968105 -76 aattagttaacagcccacttaaggtggttgt 5 38 1 cagcccctta 0.989448 -120 cccacaaaatcagcccccaaacttataataa 5 79 0 cagccccaaa 0.993989 -79 tcaaggggtgaaccccacaaaatcagccccc 5 92 0 aacccccaaa 0.960178 -66 ctcgtagttgatgcccacctaaatcgcgttt 6 130 1 atgcccccta 0.956151 -171 tgtgatggtccagcccccataataaattcac 6 160 1 cagccccata 0.996769 -141 ****** **** Masking position 11 Map Score: 5.9875 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 1 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 AAACCTGATTTATTTTTATAGAAAC 1 6 1 TGATTTATTT 0.882616 -132 TTAGTATGAGTGCTTAATTTAAATTATTAG 1 57 0 TGCTTAATTT 0.873456 -81 CAATCTAAAGGGATTAATATATTAGTATGA 1 78 0 GGATTAATAT 0.869414 -60 TAGGATTAATTTTACTTCAAGC 2 13 0 GGATTAATTT 0.967841 -12 CAGAGTAATTTTATTAATATTTATCTAACT 3 19 0 TTATTAATAT 0.655203 -70 TTAAATGGCTTTGTTAATTTGTTTAGATGT 4 14 1 TTGTTAATTT 0.916669 -175 AATAAATATAGTTTTTATTTTTATTAATAA 4 76 0 GTTTTTATTT 0.703246 -113 AATGAGCCGTTTTCTAATTTTGTTATAATT 4 151 1 TTTCTAATTT 0.675123 -38 gtggttgttttggtttatttattataagtt 5 61 1 tggtttattt 0.906371 -97 ataagtttgggggctgattttgtggggttc 5 84 1 gggctgattt 0.83555 -74 ccccttgactgggctaatttcttattttgt 5 115 1 gggctaattt 0.956037 -43 aattcaacaagtattaattc 5 148 1 gtattaattc 0.681252 -10 ********** Masking position 7 Map Score: 6.11461 Number of sites scoring better than the average of aligned sites = 347 Number in coding regions = 305 Number in noncoding regions = 42 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 5 caaccaccttaagtgggctgttaactaatt 5 38 0 aagtgggctg 0.983585 -120 tattataagtttgggggctgattttgtggg 5 80 1 ttgggggctg 0.991315 -78 ggggctgattttgtggggttcaccccttga 5 93 1 ttgtggggtt 0.930207 -65 aacgcgatttaggtgggcatcaactacgag 6 130 0 aggtgggcat 0.922989 -171 tgaatttattatgggggctggaccatcaca 6 160 0 atgggggctg 0.99392 -141 ********** Masking position 5 Map Score: 2.18504 Number of sites scoring better than the average of aligned sites = 2 Number in coding regions = 1 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 TTTAATGGACTTAAAAAAGACATTGTTAATG 3 50 1 TTAAAAAGAC 0.968858 -39 TCTAAACAAATTAACAAAGCCATTTAACTT 4 10 0 TTAAAAAGCC 0.919197 -179 TAATTAATAAACACGTTGAATTAT 4 175 0 TTAAAAACAC 0.929218 -14 ccgaatcgttttctgaaagaccattgatttg 6 74 0 ttctaaagac 0.951511 -227 gggctggaccatcacaaacgcgatttaggtg 6 145 0 atcaaaacgc 0.80198 -156 gtcacgaaatttcaaaaaggcgaggtcaaaa 6 201 0 ttcaaaaggc 0.981671 -100 cgaatggaaattcgcaaaaacattgtcacga 6 225 0 ttcgaaaaac 0.892306 -76 cgaatttccattcgacaagactgcgtctcga 6 242 1 ttcgcaagac 0.934319 -59 **** ****** Masking position 7 Map Score: 3.18792 Number of sites scoring better than the average of aligned sites = 67 Number in coding regions = 61 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 7 GTATGAGTGCTTAATTTAAATTATTAGTAG 1 54 0 TTAATTTAAA 0.658313 -84 CAGCTTGAAGTAAAATTAATCCTA 2 5 1 TTGAAGTAAA 0.930806 -20 TTAATTTGTTTAGATGTATAGATTTAAATA 4 27 1 TAGATGTATA 0.852621 -162 AATAAACACGTTGAATTATAACAAAATTAG 4 164 0 TTGAATTATA 0.93248 -25 ttaatacttgttgaattataacaaaataag 5 135 0 ttgaattata 0.93248 -23 tgaaagaccattgatttgtaaccgcggttg 6 62 0 ttgatttgta 0.928594 -239 caaaatttcgtcgatgtgaatttattatgg 6 176 0 tcgatgtgaa 0.815911 -125 ********** Masking position 4 Map Score: 0.826338 Number of sites scoring better than the average of aligned sites = 108 Number in coding regions = 95 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 8 AGTTAAGCAATCTAAAGGGATTAATATATT 1 85 0 TCTAAAGGGA 0.98821 -53 GATATTTGATTATAAAGGGAAGTTTTAAAG 1 115 0 TATAAAGGGA 0.954917 -23 cgcagtcttgtcgaatggaaattcgcaaaa 6 237 0 tcgaatggaa 0.92837 -64 gcgaaagggaaaggaaattt 6 291 0 gcgaaaggga 0.98707 -10 ********** Masking position 5 Map Score: 0.177371 Number of sites scoring better than the average of aligned sites = 11 Number in coding regions = 8 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 9 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 10 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 11 ********** No masking Map Score: -1.04149e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0