AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i211_mgen_mpneu_100.orf -o211_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02580 151 Mycoplasma #2 RMG02581 45 Mycoplasma #3 RMP00477 44 Mycoplasma_pneumoniae #4 RMP00478 229 Mycoplasma_pneumoniae Motif number 1 TTCTACCACTAAACTACACCCCCTAAAACTAGATA 1 84 0 AACACACCCA 0.992548 -68 TTTAGTGGTAGAACAACAGTCTCCAAAACTGTCTG 1 106 1 GACACACTCA 0.993744 -46 gaagggaaccacattacctattgtgctgac 4 6 1 gacacaacca 0.996443 -224 atcatcaattgatccagagacactattaaaccgga 4 80 0 gacagacaca 0.985301 -150 atcaattgatgatccagaaaacacatatatttaat 4 102 1 gacagaacaa 0.93877 -128 cagaggttttgacagacacacccaagctaaggaag 4 187 1 gaaacaccca 0.992548 -43 gtgatccaccgcccccaccttccttag 4 213 0 gacaccccca 0.996845 -17 ** * *** *** * Masking position 6 Map Score: 9.19162 Number of sites scoring better than the average of aligned sites = 31 Number in coding regions = 25 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 CCTTCCCTAGAGGAGTTGAACCTCTATTTACT 1 13 0 AGAGTTGACC 0.968641 -139 AGTTTTTATCATAAATTGGCCTTCCCTAGAGG 1 32 0 ATAATTGGCT 0.957751 -120 ATAAAAACCTAGCAATTTAACTAAGTTTTTAT 1 55 0 AGAATTTACT 0.974313 -97 TTAAATTGCTAGGTTTTTATCTAGTTTTAGGG 1 67 1 AGTTTTTACT 0.781336 -85 GTGGAAGGAATCGAACCCACACAGACA 1 135 0 AGAATCGACC 0.963849 -17 ATATATTAATATTTATTGGTCTTTGTCAAAAA 2 19 1 ATTATTGGCT 0.907912 -27 actcaggattagtcatttacctccaagctaag 4 39 1 agcatttact 0.921906 -191 tttctggatcatcaattgatccagagacacta 4 90 0 ataattgacc 0.975149 -140 ** ****** ** Masking position 1 Map Score: 3.36885 Number of sites scoring better than the average of aligned sites = 119 Number in coding regions = 100 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 3 TTCCCTAGAGGAGTTGAACCTCTATTTACT 1 13 0 GAGTTGAACC 0.980355 -139 GTGGAAGGAATCGAACCCACACAGACA 1 135 0 GAATCGAACC 0.979688 -17 gaagggaaccacattaccta 4 1 1 gaagggaacc 0.994615 -229 tattaaaccggaagggatctccttagcttg 4 62 0 gaagggatct 0.961227 -168 tctggatcatcaattgatccagagacacta 4 90 0 caattgatcc 0.956324 -140 ********** Masking position 7 Map Score: 3.26579 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 21 Number in noncoding regions = 14 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 TTCAACTCCTCTAGGGAAGGCCAATTTATG 1 25 1 CTAGGGAAGG 0.990939 -127 agtcagcacaataggtaatgtggttccctt 4 12 0 ataggtaatg 0.921961 -218 catttacctccaagctaaggagatcccttc 4 52 1 caagctaagg 0.994661 -178 cagacacacccaagctaaggaaggtggggg 4 199 1 caagctaagg 0.994661 -31 ********** Masking position 7 Map Score: 2.6929 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 11 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 GTTTTTATCTAGTTTTAGGGGGTGTAGTTT 1 79 1 AGTTTTAGGG 0.969401 -73 TAGGGGGTGTAGTTTAGTGGTAGAACAACA 1 94 1 AGTTTAGTGG 0.959349 -58 CCACACAGACAGTTTTGGAGACTGTTGTTC 1 116 0 AGTTTTGGAG 0.976534 -36 ggatctccttagcttggaggtaaatgacta 4 48 0 agcttggagg 0.985813 -182 caccttccttagcttgggtgtgtctgtcaa 4 195 0 agcttgggtg 0.985813 -35 ********** Masking position 5 Map Score: 2.46563 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 29 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 AATTTAACTAAGTTTTTATCATAAATTGGC 1 44 0 AGTTTTTATC 0.971346 -108 TAAATTGCTAGGTTTTTATCTAGTTTTAGG 1 68 1 GGTTTTTATC 0.973363 -84 AATATTTATTGGTCTTTGTCAAAAAATAAG 2 26 1 GGTCTTTGTC 0.979743 -20 gtgctgactcaggattagtcatttacctcc 4 33 1 aggattagtc 0.908415 -197 ttgttgtcagaggttttgacagacacaccc 4 180 1 aggttttgac 0.96163 -50 ********** Masking position 5 Map Score: 1.17117 Number of sites scoring better than the average of aligned sites = 52 Number in coding regions = 44 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 7 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 9 ********** No masking Map Score: -4.80737e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0