AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i218_mgen_mpneu_100.orf -o218_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02025 188 Mycoplasma #2 RMP00219 21 Mycoplasma_pneumoniae #3 RMP00220 157 Mycoplasma_pneumoniae Motif number 1 TAATTCAACGTGTTTATTAATTA 1 2 0 TGTTATTATT 0.787115 -187 TAAGTAGGAGAATTTATTACTTCTAACCTTGG 1 60 0 AATTATTATT 0.728919 -129 TTCTCCTACTTACTTATTACTTATAATAAATA 1 80 1 TACTATTATT 0.874528 -109 TAATAAATATAGTTTTTATTTTTATTAATAAA 1 103 1 AGTTTTATTT 0.738511 -86 TTTTTATTTTTATTAATAAATTCTCTCGATAT 1 115 1 TATTATAATT 0.568939 -74 TAAATGGCTTTGTTAATTTGTTTAGATGTATA 1 163 0 TGTTATTTTT 0.966553 -26 cgaaacaatgttaataaacta 2 9 1 tgttataact 0.67573 -13 aatattaagttgttcataattaag 3 3 0 tgttataata 0.865309 -155 aacaacttaatattgttttattctttaatcgg 3 21 1 tatttttttt 0.904169 -137 ggggtttgaatattatttatttggttttgttg 3 83 1 tatttttatt 0.957712 -75 ttcacccgacaattgattaattaatgattatt 3 121 1 aattattatt 0.64357 -37 aattaatgattattgatagtttcagtaga 3 139 1 tattatagtt 0.918732 -19 **** **** ** Masking position 7 Map Score: 15.4907 Number of sites scoring better than the average of aligned sites = 483 Number in coding regions = 420 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 49 Fraction of orfs with sites within 600 bp upstream = 0.00787022 Motif number 2 TTTATTAATAAATTCTCTCGATATTTTCGAT 1 123 1 AATCTCTCGA 0.968517 -66 ccaagtggggaactgacccgattaaagaata 3 39 0 aatgacccga 0.991395 -119 acccccgactaaaacaccccaagtggggaac 3 57 0 aaacacccca 0.987715 -101 aaataatattcaaacccccgactaaaacacc 3 70 0 caacccccga 0.986808 -88 ttgttggtggaattcacccgacaattgatta 3 109 1 aatcacccga 0.997541 -49 ** ******** Masking position 2 Map Score: 4.35553 Number of sites scoring better than the average of aligned sites = 1 Number in coding regions = 1 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 GTTGAATTATAACAAAATTAGAAAACGGCT 1 25 1 AACAAAATTA 0.981077 -164 TAAACAAATTAACAAAGCCATTTAACTT 1 171 1 AACAAAGCCA 0.984899 -18 cgaaacaatgttaataaacta 2 4 1 aacaatgtta 0.975035 -18 taaagaataaaacaatattaagttgttcat 3 18 0 aacaatatta 0.973103 -140 gaattccaccaacaaaaccaaataaataat 3 94 0 aacaaaacca 0.983718 -64 ********** Masking position 5 Map Score: 6.94868 Number of sites scoring better than the average of aligned sites = 137 Number in coding regions = 127 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ttttattctttaatcgggtcagttccccac 3 36 1 taatcgggtc 0.959408 -122 tggggtgttttagtcgggggtttgaatatt 3 67 1 tagtcggggg 0.99744 -91 ttatttggttttgttggtggaattcacccg 3 99 1 ttgttggtgg 0.961089 -59 aattaatcaattgtcgggtgaattccacca 3 113 0 ttgtcgggtg 0.996047 -45 ********** Masking position 4 Map Score: 2.59187 Number of sites scoring better than the average of aligned sites = 4 Number in coding regions = 3 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.43493e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0