AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i221_mgen_mpneu_100.orf -o221_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02253 110 Mycoplasma #2 RMP00624 300 Mycoplasma_pneumoniae Motif number 1 AAACTCGATAATAACTAAAAGCCATAAAAC 1 17 1 ATAACTAAAA 0.869619 -94 AAACAAGCTAAAAACCACAAAACCAAGGTT 1 44 0 AAAACCACAA 0.98426 -67 ATTATGCAGTAAAACTGCAATAATATTGTT 1 76 0 AAAACTGCAA 0.974567 -35 TGCATAATGTAAAATTACACAGC 1 98 1 AAAATTACAC 0.971675 -13 actattgaataaaactaaaacaatcgttat 2 73 1 aaaactaaaa 0.981306 -228 atctacacctaaaaccacaataacgattgt 2 92 0 aaaaccacaa 0.98426 -209 aaaccaaacgaaatctacacctaaaaccac 2 104 0 aaatctacac 0.922263 -197 tgtccactgaaaaaccaaacgaaatctaca 2 115 0 aaaaccaaac 0.968501 -186 tcagtggacaaaaattgcccaccgaaaaat 2 135 1 aaaattgccc 0.834796 -166 tgcccaccgaaaaattaacaccttgacgtt 2 150 1 aaaattaaca 0.88098 -151 cgaaacattaaaatgtaatacgt 2 288 0 aacattaaaa 0.784108 -13 ********** Masking position 1 Map Score: 16.8986 Number of sites scoring better than the average of aligned sites = 470 Number in coding regions = 425 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 2 TAATAACTAAAAGCCATAAAACCTTGGTTT 1 25 1 AAGCCATAAA 0.866474 -86 AACAAGCTAAAAACCACAAAACCAAGGTTT 1 43 0 AAACCACAAA 0.98423 -68 TTATGCAGTAAAACTGCAATAATATTGTTA 1 75 0 AAACTGCAAT 0.927157 -36 tctacacctaaaaccacaataacgattgtt 2 91 0 aaaccacaat 0.987843 -210 ctactgttacaaaccgaattgtgaaaccgt 2 206 1 aaaccgaatt 0.935002 -95 ccgaattgtgaaaccgtgtttttaccacaa 2 219 1 aaaccgtgtt 0.944621 -82 tgaacgagacaaaccacgtattacatttta 2 273 1 aaaccacgta 0.969927 -28 ********** Masking position 2 Map Score: 6.00525 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 69 Number in noncoding regions = 5 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 TCAATAAAACTCGATAATAAC 1 2 1 CAATAAAACT 0.859212 -109 TAACTAAAAGCCATAAAACCTTGGTTTTGT 1 28 1 CCATAAAACC 0.972831 -83 AAGCTAAAAACCACAAAACCAAGGTTTTAT 1 40 0 CCACAAAACC 0.985529 -71 tctgtatccaacacaattccctaaaaatcc 2 23 1 acacaattcc 0.929361 -278 gtagactattgaataaaactaaaacaatcg 2 69 1 gaataaaact 0.720295 -232 acacctaaaaccacaataacgattgtttta 2 88 0 ccacaataac 0.818699 -213 gtccactgaaaaaccaaacgaaatctacac 2 114 0 aaaccaaacg 0.732491 -187 gaattattcttaataattcctcgaacgtca 2 173 0 taataattcc 0.837518 -128 gaattattaagaataattcctcctactgtt 2 184 1 gaataattcc 0.888555 -117 aaacacggtttcacaattcggtttgtaaca 2 210 0 tcacaattcg 0.871467 -91 gtttttaccacaaccaatcgttagtaatta 2 236 1 caaccaatcg 0.894144 -65 ********** Masking position 6 Map Score: 6.91227 Number of sites scoring better than the average of aligned sites = 394 Number in coding regions = 359 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 16 Fraction of orfs with sites within 600 bp upstream = 0.00256987 Motif number 4 AGGTTTTATGGCTTTTAGTTATTATCGAGT 1 19 0 GCTTTTAGTT 0.880093 -92 GCTGTGTAATTTTACATTATGC 1 99 0 TGTGTAATTT 0.89044 -12 tttagggaattgtgttggatacagatttat 2 18 0 tgtgttggat 0.924939 -283 caataacgattgttttagttttattcaata 2 75 0 tgttttagtt 0.953179 -226 tgtggttttaggtgtagatttcgtttggtt 2 103 1 ggtgtagatt 0.949193 -198 cgaacgtcaaggtgttaatttttcggtggg 2 152 0 ggtgttaatt 0.976769 -149 ********** Masking position 5 Map Score: 0.767728 Number of sites scoring better than the average of aligned sites = 208 Number in coding regions = 190 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 ********** No masking Map Score: -8.57325e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -8.57325e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -8.57325e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0