AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i225_mgen_mpneu_100.orf -o225_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG01274 119 Mycoplasma #2 RMP00596 197 Mycoplasma_pneumoniae Motif number 1 AATGGCACTAGGTTTTTTATCAAGTATCGCC 1 39 0 GGTTTTTTTC 0.90843 -81 TGCCATTAACGATGTTTTAACATCAATTAAT 1 63 1 GATGTTTTAC 0.809318 -57 gacaaaaccatttcaaaacagaaattaag 2 9 1 catttcaaac 0.945979 -189 tactttttacgatttcgaaacaaacaactta 2 36 0 gatttcgaac 0.951647 -162 ttttagtattctttttattactttttacgat 2 54 0 ctttttatac 0.891532 -144 atgagtttgtcttttcgtgtcgctcgtcaga 2 96 1 cttttcgttc 0.978662 -102 agaaatgtaacatttcttttctgacgagcga 2 115 0 catttctttc 0.988676 -83 agaaatgttacatttcttgacgtttcgacga 2 129 1 catttcttac 0.990789 -69 aaaatctcaacgtttcgtttcaggttt 2 181 1 cgtttcgttc 0.986101 -17 ******** ** Masking position 5 Map Score: 9.76646 Number of sites scoring better than the average of aligned sites = 93 Number in coding regions = 86 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 2 TTGTGCGATCAAATATTTTAAGTCTCA 1 8 1 ATCAAATATT 0.949726 -112 TAGGTTTTTTATCAAGTATCGCCCTGAGAC 1 32 0 ATCAAGTATC 0.974228 -88 ATGTTTTAACATCAATTAATGCAAAGATAG 1 74 1 ATCAATTAAT 0.93217 -46 AACTGAATAAATCAAGTAATTTTTTA 1 104 1 ATCAAGTAAT 0.991008 -16 acgatttcgaaacaaacaacttaatttctg 2 29 0 aacaaacaac 0.824679 -169 tcgaaatcgtaaaaagtaataaaaagaata 2 49 1 aaaaagtaat 0.879555 -149 tcgtcgaaacgtcaagaaatgtaacatttc 2 130 0 gtcaagaaat 0.907993 -68 ********** Masking position 5 Map Score: 4.89486 Number of sites scoring better than the average of aligned sites = 226 Number in coding regions = 207 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 15 Fraction of orfs with sites within 600 bp upstream = 0.00240925 Motif number 3 ATCGCCCTGAGACTTAAAATATTTGATCGC 1 15 0 GACTTAAAAT 0.801631 -105 AAAACCTAGTGCCATTAACGATGTTTTAAC 1 54 1 GCCATTAACG 0.930525 -66 accatttcaaaacagaaattaagttgtttg 2 17 1 aacagaaatt 0.810503 -181 cgtgtcgctcgtcagaaaagaaatgttaca 2 111 1 gtcagaaaag 0.963159 -87 cgacgaatttgacagaaacgttcgaacaaa 2 154 1 gacagaaacg 0.993326 -44 aaacctgaaacgaaacgttgag 2 186 0 acctgaaacg 0.966775 -12 ********** Masking position 7 Map Score: 1.45812 Number of sites scoring better than the average of aligned sites = 40 Number in coding regions = 36 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 CGATACTTGATAAAAAACCTAGTGCCATTA 1 41 1 TAAAAAACCT 0.86851 -79 AGATAGAACTGAATAAATCAAGTAATTTTT 1 98 1 GAATAAATCA 0.936296 -22 gacaaaaccatttcaaaaca 2 1 1 gacaaaacca 0.990208 -197 ttacgatttcgaaacaaacaacttaatttc 2 31 0 gaaacaaaca 0.896065 -167 gacacgaaaagacaaactcatgttcgcctt 2 87 0 gacaaactca 0.971634 -111 gaaacgttcgaacaaaatctcaacgtttcg 2 168 1 aacaaaatct 0.905848 -30 ********** Masking position 6 Map Score: 1.84257 Number of sites scoring better than the average of aligned sites = 234 Number in coding regions = 219 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 TTGTGCGATCAAATATTTTA 1 1 1 TTGTGCGATC 0.989503 -119 TTTTAAGTCTCAGGGCGATACTTGATAAAA 1 26 1 CAGGGCGATA 0.958364 -94 ATAAAAAACCTAGTGCCATTAACGATGTTT 1 50 1 TAGTGCCATT 0.905323 -70 TTGATTTATTCAGTTCTATCTTTGCATTAA 1 89 0 CAGTTCTATC 0.904288 -31 atactaaaaataaggcgaacatgagtttgt 2 76 1 taaggcgaac 0.923612 -122 cgttgagattttgttcgaacgtttctgtca 2 163 0 ttgttcgaac 0.944702 -35 ********** Masking position 8 Map Score: 0.587682 Number of sites scoring better than the average of aligned sites = 36 Number in coding regions = 34 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 6 ********** No masking Map Score: 2.51122e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.51122e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 2.51122e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0