AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i232_mgen_mpneu_100.orf -o232_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG02914 110 Mycoplasma #2 RMP00301 60 Mycoplasma_pneumoniae Motif number 1 AACAACTTTTTTACGATAATGATTTTG 1 8 1 TTTTTACGAT 0.988432 -103 ATGATTAATTTTGTCTGGCTGAGTTACAAC 1 49 0 TTGTCTGGCT 0.975458 -62 TACTATTTTATTGTTACGATGATTAATTTT 1 67 0 TTGTTACGAT 0.994828 -44 cacttagcgcttttttggatt 2 2 0 ttttttggat 0.988626 -59 attacatcgattgttagtatt 2 50 1 ttgttagtat 0.981736 -11 ********** Masking position 4 Map Score: 7.19579 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 47 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 2 ACAACTTTTTTACGATAATGATTTTGAAATT 1 12 1 TAGATAATGA 0.976389 -99 ATTTTATTGTTACGATGATTAATTTTGTCTG 1 62 0 TAGATGATTA 0.991046 -49 AATAGTACCTTCTGATGTTAAGTCTTTTTGT 1 90 1 TCGATGTTAA 0.973268 -21 gcgctaagtgtcatataataatagaatgatt 2 22 1 tctataataa 0.930055 -39 catataataatagaatgattacatcgattgt 2 33 1 taaatgatta 0.965338 -28 ** ******** Masking position 6 Map Score: 2.04205 Number of sites scoring better than the average of aligned sites = 70 Number in coding regions = 60 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 3 Fraction of orfs with sites within 600 bp upstream = 0.00048185 Motif number 3 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.10731e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0