AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i248_mgen_mpneu_300.orf -o248_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG05654 202 Mycoplasma #2 RMG04524 17 Mycoplasma #3 RMP00416 184 Mycoplasma_pneumoniae Motif number 1 AAACTTTTAAATGATATTGCTTTT 1 5 1 TTTTAAATGA 0.876527 -198 TTAATGTAATTTTTAAATTAAATAAACTAG 1 45 1 TTTTAAATTA 0.867444 -158 TTTTAATAGTAACTAGTTTATTTAATTTAA 1 57 0 AACTAGTTTA 0.894424 -146 ATAGAAGCTTTTTTAAATGAAGCGTTATTA 1 88 1 TTTTAAATGA 0.876527 -115 AATGAAGCGTTATTAGCTTATTTTTTAGTA 1 103 1 TATTAGCTTA 0.953145 -100 CTAGGCTAATTATTAGGTTACTAAAAAATA 1 121 0 TATTAGGTTA 0.917038 -82 AATTAGCCTAGTTTAGTTTACTTCAACTAG 1 140 1 GTTTAGTTTA 0.816476 -63 TATTAGATTATACTAGTTGAAGTAAACTAA 1 152 0 TACTAGTTGA 0.97999 -51 TGGATGTTGTTATTAGATTATACTAGTTGA 1 162 0 TATTAGATTA 0.967973 -41 TGTTTTATTAATTTGGT 2 3 0 TATTAATTTG 0.84894 -15 agcttaatttttttaactgaaccgctcatg 3 20 1 ttttaactga 0.826898 -165 gtattacaagtactagtttgccaaagacaa 3 69 1 tactagtttg 0.950219 -116 tggttggtgcaactagttgaggggcgctaa 3 100 1 aactagttga 0.901867 -85 tactagattattctagttggctttaaggaa 3 134 0 ttctagttgg 0.933486 -51 aatagtgcattactagattattctagttgg 3 144 0 tactagatta 0.970402 -41 ********** Masking position 5 Map Score: 23.6723 Number of sites scoring better than the average of aligned sites = 372 Number in coding regions = 327 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 2 AAACTTTTAAATGATATTGCTTTTCTAAAAGCA 1 10 1 AATAATTTTT 0.938884 -193 TTAATTTAAAAATTACATTAATTGCTTTTAGAAA 1 32 0 AATAATTTTG 0.934465 -171 TTTTTAAATTAAATAAACTAGTTACTATTAAAAC 1 54 1 AAAAACTTTA 0.715582 -149 GCTTCATTTAAAAAAGCTTCTATGTTTTAATAGT 1 77 0 AAAACTTATG 0.88666 -126 AAAATAAGCTAATAACGCTTCATTTAAAAAAGCT 1 93 0 AATAGCTATT 0.650005 -110 GTAACCTAATAATTAGCCTAGTTTAGTTTACTTC 1 130 1 AATACCTTTT 0.970454 -73 GTTGTTATTAGATTATACTAGTTGAAGTAAACTA 1 153 0 GATAACTTTG 0.826356 -50 TTGTTCTAAAAAGCTTTAATTTGGATGTTGT 1 182 0 AAAACTTATT 0.878751 -21 acttaattaagcttaatttttttaactg 3 5 1 aatagctatt 0.499578 -180 ttaaatcaggttagattttgcaatagt 3 168 0 aatagttatt 0.931734 -17 *** * *** *** Masking position 9 Map Score: 6.49013 Number of sites scoring better than the average of aligned sites = 329 Number in coding regions = 302 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 ATGATATTGCTTTTCTAAAAGCAATTAATG 1 21 1 TTTTCTAAAA 0.890076 -182 TAATTATTAGGTTACTAAAAAATAAGCTAA 1 115 0 GTTACTAAAA 0.95595 -88 CCTAGTTTAGTTTACTTCAACTAGTATAAT 1 146 1 TTTACTTCAA 0.939843 -57 TTGTTCTAAAAAGCTTTAATT 1 192 0 TGTTCTAAAA 0.954045 -11 gcgctaaacctttccttaaagccaactaga 3 123 1 tttccttaaa 0.95909 -62 ********** Masking position 6 Map Score: 2.45081 Number of sites scoring better than the average of aligned sites = 69 Number in coding regions = 60 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 ********** No masking Map Score: -6.65478e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -6.65478e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -6.65478e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0