AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i263_mgen_mpneu_300.orf -o263_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.36
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMG04679	52	Mycoplasma
#2	RMP00501	243	Mycoplasma_pneumoniae

Motif number 1

       ggacctggacagcacaaatggctgt	2	4	1	ctggcagcac	    0.981454	-240
tagaattaaacaatttaagctctttgagaaaa	2	57	1	cattaagctc	    0.984365	-187
tggaggggatcaaatgcaccaccaaagatcac	2	95	0	caatcaccac	    0.980051	-149
gctttaatggcttgtacagcacgcttagcaat	2	143	0	ctgtcagcac	    0.994219	-101
gctgtacaagccattaaagcacaaaagcttta	2	155	1	cattaagcac	    0.996713	-89
tttaaatcaccgattaaagcatctaatcaagc	2	212	1	cattaagcat	    0.975209	-32
attaaagcatctaatcaagcacgtttagca  	2	224	1	caataagcac	    0.995297	-20
          * *** ******

Masking position 8
Map Score:   11.5298

Number of sites scoring better than the average of aligned sites = 29
Number in coding regions = 27
Number in noncoding regions = 2
Number of orfs with sites within 600 bp upstream = 1
Fraction of orfs with sites within 600 bp upstream = 0.000160617


Motif number 2

CTTGTGTCACAATTATTTTAGTTAGAATTA	1	15	1	AATTATTTTA	    0.929376	-38
AGTTAGAATTAAATGTTTTAAGATCTTTT 	1	34	1	AAATGTTTTA	    0.982619	-19
ggacagcacaaatggctgtagctatcagga	2	17	1	aatggctgta	    0.942234	-227
tagctatcaggattattttagttagaatta	2	35	1	gattatttta	    0.777555	-209
aaagagcttaaattgtttaattctaactaa	2	52	0	aattgtttaa	    0.911595	-192
attaaagcacaaaagctttactttgtacca	2	167	1	aaaagcttta	    0.925685	-77
gtgatttaaaaaaggctttagcagttggta	2	192	0	aaaggcttta	    0.982674	-52
gtgcttgattagatgctttaatcggtgatt	2	216	0	agatgcttta	    0.960328	-28
          **********

Masking position 10
Map Score:   8.44347

Number of sites scoring better than the average of aligned sites = 474
Number in coding regions = 428
Number in noncoding regions = 46
Number of orfs with sites within 600 bp upstream = 30
Fraction of orfs with sites within 600 bp upstream = 0.0048185


Motif number 3

         TGCTCTTGTGTCACAATTATTTT	1	2	1	GCCTTGTTCA	    0.972632	-51
gatagctacagccatttgtgctgtccaggtcc	2	11	0	gcatttggct	    0.911554	-233
aacaatttaagctctttgagaaaaaaaatagt	2	65	1	gcctttggaa	    0.990236	-179
atgtagatatgcgcttggtggaggggatcaaa	2	113	0	gccttgggga	    0.988172	-131
ggcttgtacagcacgcttagcaatgtagatat	2	135	0	gccgcttgca	    0.972415	-109
aaaggctttagcagttggtacaaagtaaagct	2	180	0	gcgttggaca	    0.957968	-64
aactgctaaagccttttttaaatcaccgatta	2	196	1	gctttttaaa	      0.7296	-48
atctaatcaagcacgtttagca          	2	232	1	gccgtttgca	    0.992522	-12
          ** ***** ***

Masking position 2
Map Score:   4.91157

Number of sites scoring better than the average of aligned sites = 92
Number in coding regions = 86
Number in noncoding regions = 6
Number of orfs with sites within 600 bp upstream = 4
Fraction of orfs with sites within 600 bp upstream = 0.000642467


Motif number 4

AATTCTAACTAAAATAATTGTGACACAAGAGCA	1	11	0	AAAAAATTGA	    0.995206	-42
aattctaactaaaataatcctgatagctacagc	2	31	0	aaaaaattga	    0.995206	-213
ctctttgagaaaaaaaatagtgatctttggtgg	2	76	1	aaaaaattga	    0.995206	-168
          **** ***  ***

Masking position 7
Map Score:   1.90245

Number of sites scoring better than the average of aligned sites = 31
Number in coding regions = 26
Number in noncoding regions = 5
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 5

cttgtacagcacgcttagcaatgtagatat	2	135	0	acgcttagca	    0.996965	-109
ctaatcaagcacgtttagca          	2	234	1	acgtttagca	    0.995505	-10
          **********

Masking position 5
Map Score:   0.609702

Number of sites scoring better than the average of aligned sites = 3
Number in coding regions = 3
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   7.34864e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 7

          **********

No masking
Map Score:   7.34864e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 8

          **********

No masking
Map Score:   7.34864e-14

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0