AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i266_mgen_mpneu_100.orf -o266_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.36
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00504	194	Mycoplasma_pneumoniae

Motif number 1

actagaatccgtggaacttcaggacttaac	1	18	0	gtggaacttc	    0.994894	-177
tactggtaaaatgggaatttttcccattaa	1	51	0	atgggaattt	    0.829404	-144
aagatcgattgtgaatattctttacttaat	1	89	0	gtgaatattc	    0.936153	-106
aatattcacaatcgatcttctcctgctgcc	1	100	1	atcgatcttc	    0.946375	-95
aataaaacgaatggaacgtgtcgtttgtga	1	153	1	atggaacgtg	    0.963521	-42
cgtgtcgtttgtgaggcgtcgttttggacg	1	169	1	gtgaggcgtc	    0.978712	-26
          gtgggtcgtccaaaacgacg	1	185	0	gtgggtcgtc	    0.996075	-10
          **********

Masking position 2
Map Score:   6.81685

Number of sites scoring better than the average of aligned sites = 81
Number in coding regions = 70
Number in noncoding regions = 11
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 2

atcttctcctgctgccgttttctcacgaca	1	114	1	gctgccgttt	    0.992586	-81
attcattcaggatgtcgtgagaaaacggca	1	126	0	gatgtcgtga	    0.937183	-69
acgacacgttccattcgttttattcattca	1	147	0	ccattcgttt	    0.939298	-48
acgaatggaacgtgtcgtttgtgaggcgtc	1	159	1	cgtgtcgttt	    0.995123	-36
tcgtttgtgaggcgtcgttttggacgaccc	1	173	1	ggcgtcgttt	    0.994297	-22
          **********

Masking position 8
Map Score:   3.52293

Number of sites scoring better than the average of aligned sites = 6
Number in coding regions = 6
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 3

       aaaaatggttaagtcctgaagtt	1	4	1	aatggttaag	    0.983887	-191
ctagtctattaatgggaaaaattcccattt	1	43	1	aatgggaaaa	    0.988701	-152
tcaaattactactggtaaaatgggaatttt	1	60	0	actggtaaaa	    0.983887	-135
cgacatcctgaatgaataaaacgaatggaa	1	139	1	aatgaataaa	    0.936945	-56
          **********

Masking position 3
Map Score:   1.86314

Number of sites scoring better than the average of aligned sites = 92
Number in coding regions = 84
Number in noncoding regions = 8
Number of orfs with sites within 600 bp upstream = 4
Fraction of orfs with sites within 600 bp upstream = 0.000642467


Motif number 4

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0