AlignACE version 2.2  July 7, 1998
/home/amcguire/bin/alignACE -i299_mgen_mpneu_100.orf -o299_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e 
Parameter values:
 expect =  	5
 ncols =   	10
 npass =   	1000
 maxnpass =	100
 nruns =   	1000
 maxnruns =	100
 repeat =  	15
 maxreps = 	3
 nread =   	500
 ncycles = 	1
 fragment =	1
 psfact =  	0.1
 gcback =  	0.36
 maxlen =  	30
 weight =  	0.8
 exclude = 	1

Input sequences:
#1	RMP00504	194	Mycoplasma_pneumoniae

Motif number 1

gttaagtcctgaagttccacggattctagt	1	18	1	gaagttccac	    0.995297	-177
ttaatgggaaaaattcccattttaccagta	1	51	1	aaattcccat	    0.841026	-144
attaagtaaagaatattcacaatcgatctt	1	89	1	gaatattcac	    0.941019	-106
ggcagcaggagaagatcgattgtgaatatt	1	100	0	gaagatcgat	    0.950186	-95
tcacaaacgacacgttccattcgttttatt	1	153	0	cacgttccat	    0.966376	-42
cgtccaaaacgacgcctcacaaacgacacg	1	169	0	gacgcctcac	    0.980402	-26
cgtcgttttggacgacccac          	1	185	1	gacgacccac	    0.996315	-10
          **********

Masking position 2
Map Score:   6.81685

Number of sites scoring better than the average of aligned sites = 81
Number in coding regions = 70
Number in noncoding regions = 11
Number of orfs with sites within 600 bp upstream = 5
Fraction of orfs with sites within 600 bp upstream = 0.000803084


Motif number 2

taaagaatattcacaatcgatcttctcctg	1	95	1	tcacaatcga	     0.99459	-100
aaacgacgcctcacaaacgacacgttccat	1	163	0	tcacaaacga	    0.997444	-32
  gtgggtcgtccaaaacgacgcctcacaa	1	177	0	tccaaaacga	    0.991387	-18
          **********

Masking position 5
Map Score:   4.22617

Number of sites scoring better than the average of aligned sites = 1
Number in coding regions = 1
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 3

cttcaggacttaaccattttt         	1	2	0	taaccatttt	    0.977516	-193
atgggaatttttcccattaatagactagaa	1	41	0	ttcccattaa	    0.985323	-154
atgggaaaaattcccattttaccagtagta	1	54	1	ttcccatttt	    0.995252	-141
          **********

Masking position 6
Map Score:   1.38806

Number of sites scoring better than the average of aligned sites = 11
Number in coding regions = 11
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 4

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 5

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0


Motif number 6

          **********

No masking
Map Score:   3.15071e-13

Number of sites scoring better than the average of aligned sites = 0
Number in coding regions = 0
Number in noncoding regions = 0
Number of orfs with sites within 600 bp upstream = 0
Fraction of orfs with sites within 600 bp upstream = 0