AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i303_mgen_mpneu_100.orf -o303_mgen_mpneu_100.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG03030 66 Mycoplasma #2 RMP00236 54 Mycoplasma_pneumoniae Motif number 1 AACAATATTTTTCTATTTAAT 1 1 0 TTCTATTAAT 0.988694 -66 TATAATAATTTTATTAACAATATTTTTCTAT 1 16 0 TTATTAAAAT 0.950147 -51 ATCTTAAAACATATAATAATTTTATTAACAA 1 27 0 ATATAATATT 0.938725 -40 GTTTTAAGATTTCTATTAATTCAAGTAAT 1 48 1 TTCTATTATT 0.98536 -19 ttaaattcatttataatcaatcttcgcagta 2 11 0 ttataataat 0.990034 -44 aaataaccagttatattaaattcatttataa 2 26 0 ttatattaat 0.989924 -29 atataactggttatttaaatcctt 2 41 1 ttatttaatc 0.854384 -14 ******* *** Masking position 9 Map Score: 10.1095 Number of sites scoring better than the average of aligned sites = 189 Number in coding regions = 148 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 ATTAACAATATTTTTCTATTTAAT 1 5 0 TTTTTCTATT 0.945548 -62 AAACATATAATAATTTTATTAACAATATTT 1 22 0 TAATTTTATT 0.887453 -45 TATGTTTTAAGATTTCTATTAATTCAAGTA 1 45 1 GATTTCTATT 0.990649 -22 atattaaattcatttataatcaatcttcgc 2 15 0 catttataat 0.960108 -40 tttaaataaccagttatattaaattcattt 2 30 0 cagttatatt 0.978288 -25 aaggatttaaataaccagttata 2 42 0 gatttaaata 0.593394 -13 ********** Masking position 5 Map Score: 3.7124 Number of sites scoring better than the average of aligned sites = 225 Number in coding regions = 186 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0