AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i303_mgen_mpneu_300.orf -o303_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG03030 66 Mycoplasma #2 RMP00236 54 Mycoplasma_pneumoniae Motif number 1 ATTAAATAGAAAAATATTGTT 1 1 1 ATTAATAGAA 0.986971 -66 ATAGAAAAATATTGTTAATAAAATTATTATA 1 16 1 ATTTTAATAA 0.942769 -51 TTGTTAATAAAATTATTATATGTTTTAAGAT 1 27 1 AATATTATAT 0.930519 -40 ATTACTTGAATTAATAGAAATCTTAAAAC 1 48 0 AATAATAGAA 0.983129 -19 tactgcgaagattgattataaatgaatttaa 2 11 1 attattataa 0.988527 -44 ttataaatgaatttaatataactggttattt 2 26 1 attaatataa 0.989088 -29 aaggatttaaataaccagttatat 2 41 0 gattaaataa 0.835273 -14 *** ******* Masking position 8 Map Score: 10.1095 Number of sites scoring better than the average of aligned sites = 189 Number in coding regions = 148 Number in noncoding regions = 41 Number of orfs with sites within 600 bp upstream = 39 Fraction of orfs with sites within 600 bp upstream = 0.00626405 Motif number 2 ATTAAATAGAAAAATATTGTTAATAAAA 1 9 1 GAAAAATATT 0.87291 -58 ATATTGTTAATAAAATTATTATATGTTTTA 1 24 1 TAAAATTATT 0.973608 -43 AATAGAAATCTTAAAACATATAATAATTTT 1 35 0 TTAAAACATA 0.879205 -32 ATTACTTGAATTAATAGAAATCTTA 1 52 0 TTGAATTAAT 0.879391 -15 taaattcatttataatcaatcttcgcagta 2 11 0 tataatcaat 0.915072 -44 accagttatattaaattcatttataatcaa 2 22 0 ttaaattcat 0.961247 -33 aactggttatttaaatcctt 2 45 1 ttaaatcctt 0.981568 -10 ********** Masking position 5 Map Score: 6.50676 Number of sites scoring better than the average of aligned sites = 767 Number in coding regions = 684 Number in noncoding regions = 83 Number of orfs with sites within 600 bp upstream = 55 Fraction of orfs with sites within 600 bp upstream = 0.00883392 Motif number 3 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0