AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i312_mgen_mpneu_300.orf -o312_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG05344 25 Mycoplasma #2 RMG04236 300 Mycoplasma #3 RMP00155 300 Mycoplasma_pneumoniae #4 RMP00158 67 Mycoplasma_pneumoniae #5 RMP00161 22 Mycoplasma_pneumoniae Motif number 1 AGTTTCTTTTAATAATACTGATTCTTTTAA 2 154 1 AATAATACTG 0.854592 -147 TAATGGAATCACTAATATCACTACCATTAA 2 180 0 ACTAATATCA 0.763118 -121 CAAATAGACACATAATATCAGACCCTCAAA 2 210 1 CATAATATCA 0.943825 -91 tagcataatactaaataaatact 3 4 1 cataatacta 0.972323 -297 ataatactaaataaatactaataatattaa 3 15 1 ataaatacta 0.918761 -286 ctactaatagcttaatattattagtattta 3 26 0 cttaatatta 0.951629 -275 ataatattatcttaatattatttacctact 3 51 0 cttaatatta 0.951629 -250 ttttctttaacataatattatcttaatatt 3 62 0 cataatatta 0.930218 -239 ccgtttactattaaatactaatcttctata 3 107 0 ttaaatacta 0.781362 -194 ttccattttcctatataccactttcttttt 3 151 1 ctatatacca 0.661792 -150 ttgggcacattttaataccacgttggtagc 3 186 1 tttaatacca 0.927859 -115 ttggtagcatcttaataccctgatggtatt 3 208 1 cttaataccc 0.905015 -93 taccgacgaaattaataccatcagggtatt 3 221 0 attaatacca 0.97602 -80 ttcgtcggtaaataataccggaataatact 3 241 1 aataataccg 0.881032 -60 ataataccggaataatactaaataaatatt 3 252 1 aataatacta 0.956318 -49 ataatactaaataaatattagaatttaagc 3 263 1 ataaatatta 0.811044 -38 ********** Masking position 5 Map Score: 23.0955 Number of sites scoring better than the average of aligned sites = 144 Number in coding regions = 129 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 2 AGAGTTTATCTTTTTCATTAACATCGCCTTT 2 44 0 TTTTCATTAA 0.696713 -257 TGAAAAAGATAAACTCTTTTTAGCAAGAAAA 2 58 1 AACTCTTTTT 0.767681 -243 TGGCTTCTCCATATGCTTTTAAAATACCTCT 2 89 0 AATGCTTTTA 0.879485 -212 AACCCTTTATAAATTCTTTTTTCAGCAATAT 2 120 0 AATTCTTTTT 0.940634 -181 AAGGGTTAGCAGTTTCTTTTAATAATACTGA 2 144 1 ATTTCTTTTA 0.972217 -157 TTAATAATACTGATTCTTTTAATGGTAGTGA 2 162 1 TATTCTTTTA 0.959842 -139 TGAGATAGTTTCTTTAATTAAACCATC 2 284 0 ATTTCTTTAA 0.959842 -17 atagagaaactttttctttaacataatatta 3 72 0 ttttctttaa 0.942283 -229 cctatataccactttctttttcgcggttggg 3 160 1 atttcttttt 0.940635 -141 tccttttataattctttaagtgtttaatt 4 9 1 tattctttaa 0.942281 -59 * ********* Masking position 8 Map Score: 11.4541 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 235 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 3 GAAACAATTAATCAGGTGATTAT 1 13 0 GAAACAAATC 0.91352 -13 CGATGTTAATGAAAAAGATAAACTCTTTTTAGC 2 49 1 GAAAAGAAAC 0.992304 -252 ATTATTAAAAGAAACTGCTAACCCTTTATAAAT 2 137 0 GAAACGAACC 0.98791 -164 gtatttaatagtaaacggcaaacaaatttgttt 3 119 1 gtaaagaaac 0.975141 -182 tggtatataggaaaatggaaaacaaatttgttt 3 138 0 gaaaagaaac 0.992311 -163 ***** * **** Masking position 4 Map Score: 1.14649 Number of sites scoring better than the average of aligned sites = 22 Number in coding regions = 19 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 AGTGGTGATAACCAAAACAAAACCATTCCC 2 11 1 ACCAAAACAA 0.813952 -290 ACCACTAGCATCATAAATAAGGTTTTGAGG 2 233 0 TCATAAATAA 0.755642 -68 TTAAACCATCAGCAAAATAACCTAGAAGGT 2 264 0 AGCAAAATAA 0.936635 -37 tagcataatactaaataaatactaataa 3 9 1 tactaaataa 0.912536 -292 agctattagtaggtaaataatattaagata 3 44 1 aggtaaataa 0.947516 -257 tataggaaaatggaaaacaaatttgtttgc 3 136 0 tggaaaacaa 0.892448 -165 ttaatttcgtcggtaaataataccggaata 3 236 1 cggtaaataa 0.913717 -65 accggaataatactaaataaatattagaat 3 257 1 tactaaataa 0.912536 -44 ********** Masking position 5 Map Score: 2.68001 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 152 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 5 TTATAATCACCTGATTAATTG 1 2 1 TATAATCACC 0.836543 -24 TTGTTTTGGTTATCACCACT 2 1 0 TATCACCACT 0.880542 -300 ACCAAAACAAAACCATTCCCCGCAAAGGCG 2 21 1 AACCATTCCC 0.840804 -280 GAATCACTAATATCACTACCATTAAAAGAA 2 175 0 TATCACTACC 0.958454 -126 CCTAGAAGGTTACCACTAGCATCATAAATA 2 244 0 TACCACTAGC 0.973173 -57 TCTTTAATTAAACCATCAGCAAAATAACCT 2 271 0 AACCATCAGC 0.964273 -30 acgaaattaataccatcagggtattaagat 3 216 0 taccatcagg 0.934321 -85 ********** Masking position 5 Map Score: 0.415443 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 240 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0