AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i326_mgen_mpneu_300.orf -o326_mgen_mpneu_300.ace -a/home/amcguire/genomes/ORF_mgen.txt -z/home/amcguire/genomes/mgen.fna -g0.36 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.36 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMG03712 200 Mycoplasma #2 RMP00543 38 Mycoplasma_pneumoniae Motif number 1 GCCTGATATCTATATACTAAATAGTGCCAT 1 12 1 TATATACTAA 0.946056 -189 AACTTTTAATTTTTTACAAGTAGCTATTAG 1 49 1 TTTTTACAAG 0.955111 -152 CTGGTAGTTTTCTTTACTAATAGCTACTTG 1 65 0 TCTTTACTAA 0.964987 -136 ACTACCAGAAATTAAACTAGGATTACACTT 1 87 1 ATTAAACTAG 0.954194 -114 CTAGGATTACACTTAAAAAAGTTAGTTTAA 1 103 1 ACTTAAAAAA 0.690891 -98 TTTACTAGTTTTTAAACTAACTTTTTTAAG 1 114 0 TTTAAACTAA 0.950535 -87 TATTAACACTTTTTTACTAGTTTTTAAACT 1 126 0 TTTTTACTAG 0.977684 -75 AAAATTCACTAATTAACTAACAAAAATTAT 1 163 0 AATTAACTAA 0.946083 -38 ATTTTAACTGAATATACAAGTAG 1 188 1 AATATACAAG 0.928493 -13 gatgagcttaattttaaaaatgtaaaataa 2 16 0 attttaaaaa 0.699683 -23 ********** Masking position 6 Map Score: 12.157 Number of sites scoring better than the average of aligned sites = 530 Number in coding regions = 437 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 2 GCTACTTGTAAAAAATTAAAAGTTAGAATTA 1 42 0 AAAAATTAAA 0.972476 -159 TTACACTTAAAAAAGTTAGTTTAAAAACTAG 1 109 1 AAAAGTTATT 0.883635 -92 AAGTTAGTTTAAAAACTAGTAAAAAAGTGTT 1 121 1 AAAAACTATA 0.973344 -80 AAAACTAGTAAAAAAGTGTTAATACTCCTTA 1 132 1 AAAAAGTGTA 0.953317 -69 ATTAACTAACAAAAATTATTAAGGAGTATTA 1 151 0 AAAAATTATA 0.987731 -50 ATATTCAGTTAAAATTCACTAATTAACTAAC 1 172 0 AAAATTCATA 0.930527 -29 cttaattttaaaaatgtaaaataacggcc 2 9 0 aaaatgtaaa 0.940117 -30 ******** ** Masking position 4 Map Score: 6.09338 Number of sites scoring better than the average of aligned sites = 217 Number in coding regions = 180 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 3 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.00336e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0