AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i129_mjan_pyro_300.orf -o129_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00900 127 Pyrococcus_OT3 Motif number 1 GGTGATACCTTTAAAAAGCTTAGAAAAAACA 1 50 0 TTAAAAACTT 0.996383 -78 AAACATTCTGTTAAGTAACTTCACTTATCCG 1 80 0 TTAAGTACTT 0.989204 -48 GATTGTTAACTTAAAAACATTCTGTTAAGTA 1 94 0 TTAAAAAATT 0.985781 -34 TGTTTTTAAGTTAACAATCTTGAGGATTAGT 1 106 1 TTAACAACTT 0.995699 -22 ******* *** Masking position 7 Map Score: 5.63339 Number of sites scoring better than the average of aligned sites = 154 Number in coding regions = 129 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 2 CGAAGAGAGCTCTAGGGATAACT 1 4 0 TCTAGGGATA 0.824968 -124 AGAAAAAACATCACGCGAGATGGAAGCGAA 1 30 0 TCACGCGAGA 0.518388 -98 TTTAAAGGTATCACCGGATAAGTGAAGTTA 1 66 1 TCACCGGATA 0.701274 -62 ********** Masking position 8 Map Score: 1.59773 Number of sites scoring better than the average of aligned sites = 5 Number in coding regions = 4 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 3 ACGCGAGATGGAAGCGAAGAGAGCTCTAGG 1 18 0 GAAGCGAAGA 0.985955 -110 ATACCTTTAAAAAGCTTAGAAAAAACATCA 1 47 0 AAAGCTTAGA 0.930286 -81 TATCACCGGATAAGTGAAGTTACTTAACAG 1 74 1 TAAGTGAAGT 0.987245 -54 TTAAAAACATTCTGTTAAGTAACTTCACTT 1 85 0 TCTGTTAAGT 0.907466 -43 AGAATGTTTTTAAGTTAACAATCTTGAGGA 1 102 1 TAAGTTAACA 0.966875 -26 ********** Masking position 8 Map Score: 1.39429 Number of sites scoring better than the average of aligned sites = 430 Number in coding regions = 377 Number in noncoding regions = 53 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 4 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.87173e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0