AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i173_mjan_pyro_100.orf -o173_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ00919 259 M_jannaschii_chromosome #2 RPH01018 214 Pyrococcus_OT3 Motif number 1 ATATTGATTTATTATGTTGAAATATTGATAAGGA 1 24 0 ATATTAAATA 0.949964 -236 AGAATCCCTTTATTTAACTAAAGAGCAATTTATA 1 55 0 TTTTAAAAGA 0.629878 -205 CCATTTATATACTATTTTAAAAGATTATCGCACT 1 90 1 ATATTAAAGA 0.855423 -170 AGATTATCGCACTTATTTAAAATATTTAAGCGGA 1 111 1 ATTATAAATA 0.887649 -149 ATGTTATTACTGAAAAACTAAATACACATTCCTA 1 166 1 TAAAAAAATA 0.60854 -94 GTCATCCATTAAAATCTACAAATAATTTTATTTT 1 214 1 AAATTAAATA 0.859536 -46 TCACCCAAAAAATAGTAAAAAATAAAATTATTTG 1 232 0 ATAGAAAATA 0.982146 -28 TAAAGCGAAAAGTTGAACAAAATATCAA 2 5 0 ATTGAAAATA 0.98462 -210 AGACGGATACATTATTATCAAATAGATGAAAGTA 2 45 0 ATATAAAATA 0.97608 -170 TGTATCCGTCTTATGTACAAAATATAACTGCAAT 2 68 1 TATGAAAATA 0.868443 -147 AATTTTTAGAATTTTGACTAAATATTATTGGATA 2 99 1 ATTTAAAATA 0.979159 -116 AGGGCTTGAGAATTGGATAAAATATCCAATAATA 2 121 0 ATTGAAAATA 0.976578 -94 GCTATCTCCAAGTTGGACAAAATATCCAAGAGGT 2 185 1 ATTGAAAATA 0.98462 -30 * *** * ***** Masking position 10 Map Score: 17.5707 Number of sites scoring better than the average of aligned sites = 1101 Number in coding regions = 875 Number in noncoding regions = 226 Number of orfs with sites within 600 bp upstream = 204 Fraction of orfs with sites within 600 bp upstream = 0.0327658 Motif number 2 AAATATAAATTAATCCTTATCAA 1 3 1 ATATAAATTA 0.938742 -257 AGAGCAATTTATATTGATTTATTATGTTGAA 1 37 0 ATATTGATTA 0.941088 -223 TTAAAATAGTATATAAATGGAAGAATCCCTT 1 79 0 ATATAAATGA 0.981922 -181 GGTTTATATGTTATTACTGAAAAACTAAATA 1 159 1 TTATTACTGA 0.91529 -101 TTATTTGTAGATTTTAATGGATGACTTTATT 1 208 0 ATTTTAATGA 0.917962 -52 ACTTTTCGCTTTATTGATTTACTTTCATCTA 2 26 1 TTATTGATTA 0.816078 -189 CATTATTATCAAATAGATGAAAGTAAATCAA 2 39 0 AAATAGATGA 0.844762 -176 CATCTATTTGATAATAATGTATCCGTCTTAT 2 51 1 ATAATAATGA 0.917957 -164 TATGTACAAAATATAACTGCAATTTTTAGAA 2 79 1 ATATAACTGA 0.963703 -136 TTTTGACTAAATATTATTGGATATTTTATCC 2 110 1 ATATTATTGA 0.93443 -105 ********* * Masking position 8 Map Score: 9.3824 Number of sites scoring better than the average of aligned sites = 833 Number in coding regions = 716 Number in noncoding regions = 117 Number of orfs with sites within 600 bp upstream = 110 Fraction of orfs with sites within 600 bp upstream = 0.0176678 Motif number 3 CAATATTTCAACATAATAAATCAATATAAA 1 31 1 ACATAATAAA 0.900413 -229 TAATCTTTTAAAATAGTATATAAATGGAAG 1 87 0 AAATAGTATA 0.90418 -173 GTTATTACTGAAAAACTAAATACACATTCC 1 168 1 AAAAACTAAA 0.93218 -92 TTCCTAAGATAAGTAATAAAGTCATCCATT 1 194 1 AAGTAATAAA 0.900413 -66 ATCACCCAAAAAATAGTAAAAAATAAAATT 1 237 0 AAATAGTAAA 0.978473 -23 TATTTAGTCAAAATTCTAAAAATTGCAGTT 2 93 0 AAATTCTAAA 0.942308 -122 CTCATGCCATAAATCCTAAAAGCCTTGAAT 2 153 1 AAATCCTAAA 0.96033 -62 ********** Masking position 8 Map Score: 5.48149 Number of sites scoring better than the average of aligned sites = 669 Number in coding regions = 463 Number in noncoding regions = 206 Number of orfs with sites within 600 bp upstream = 174 Fraction of orfs with sites within 600 bp upstream = 0.0279473 Motif number 4 TGGATTTCCGCTTAAATATTTTAAATAAGT 1 121 0 CTTAAATATT 0.915861 -139 TATTACTTATCTTAGGAATGTGTATTTAGT 1 182 0 CTTAGGAATG 0.870504 -78 ACTAAATATTATTGGATATTTTATCCAATT 2 115 1 ATTGGATATT 0.914464 -100 GGCATGAGGGCTTGAGAATTGGATAAAATA 2 131 0 CTTGAGAATT 0.935035 -84 TCCTAAAAGCCTTGAATCTGCTATCTCCAA 2 166 1 CTTGAATCTG 0.910556 -49 TTTTGTCCAACTTGGAGATAGCAGATTCAA 2 177 0 CTTGGAGATA 0.918603 -38 ACTTTCACCTCTTGGATATTTTGTCCAACT 2 195 0 CTTGGATATT 0.988012 -20 ********** Masking position 3 Map Score: 2.1818 Number of sites scoring better than the average of aligned sites = 424 Number in coding regions = 384 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 5 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0