AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i210_mjan_pyro_100.orf -o210_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ05016 29 M_jannaschii_chromosome #2 RPH01513 112 Pyrococcus_OT3 Motif number 1 ACAGTCAAAGATTTATATAACAAATGT 1 7 1 AAAGATTATA 0.988249 -23 TAGTGTGAGAAGGGGGTTATAGGAG 2 5 0 AGGGGTTATA 0.989401 -108 TTTATAAGTTAAGAGATTATCTCTCAGTTAA 2 38 0 AAGAGTTATC 0.988419 -75 ATTCTTGTTGAAAAATTTATAAGTTAAGAGA 2 53 0 AAAAATTATA 0.984938 -60 ATTTTTCAACAAGAATTTATAAAACTAGACG 2 68 1 AAGAATTATA 0.99184 -45 ***** ***** Masking position 7 Map Score: 7.13006 Number of sites scoring better than the average of aligned sites = 200 Number in coding regions = 185 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 2 TTCTCACACTACATTAACTGAGAGATAATCTCT 2 25 1 ACTAACGAGA 0.997508 -88 AATTTATAAAACTAGACGGGAGATTTTCTCTGG 2 81 1 ACAACGGAGA 0.996988 -32 ACCACCTCACCAGAGAAAATCTCCCG 2 97 0 ACTACCGAGA 0.999082 -16 ** * *** **** Masking position 6 Map Score: 0.97235 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 2 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 ACAGTCAAAGATTTATATAACA 1 3 1 AGTCAAAGAT 0.985326 -27 CAGTTAATGTAGTGTGAGAAGGGGGTTATA 2 15 0 AGTGTGAGAA 0.990863 -98 CACTACATTAACTGAGAGATAATCTCTTAA 2 31 1 ACTGAGAGAT 0.994571 -82 ********** Masking position 7 Map Score: 0.634226 Number of sites scoring better than the average of aligned sites = 38 Number in coding regions = 36 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 CTACATTTGTTATATAAATCTTTGAC 1 14 0 TTGTTATATA 0.978716 -16 TTATAAATTCTTGTTGAAAAATTTATAAGT 2 60 0 TTGTTGAAAA 0.958141 -53 ATCTCCCGTCTAGTTTTATAAATTCTTGTT 2 75 0 TAGTTTTATA 0.972294 -38 ********** Masking position 8 Map Score: 0.0210231 Number of sites scoring better than the average of aligned sites = 158 Number in coding regions = 131 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 5 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0