AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i227_mjan_pyro_100.orf -o227_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00468 128 Pyrococcus_OT3 Motif number 1 AGAAGGTAAATTCTTTTTGGTGATGAAGA 1 10 0 TTCTTTTTGG 0.989353 -119 AAGAATTTACCTTCTTTAGGTATTTAAAGC 1 25 1 CTTCTTTAGG 0.981661 -104 TATTTAAAGCTTGCTTTTGGCTTGAGGTTT 1 45 1 TTGCTTTTGG 0.996234 -84 TATTAGGATGTCGGTTTTGGCAACTATGAA 1 73 0 TCGGTTTTGG 0.984789 -56 CATCCAGGAATTTTATTAGGATGTCGGTTT 1 86 0 TTTTATTAGG 0.959053 -43 ********** Masking position 6 Map Score: 5.42561 Number of sites scoring better than the average of aligned sites = 250 Number in coding regions = 229 Number in noncoding regions = 21 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 2 TCTTCATCACCAAAAAGAATT 1 2 1 CTTCATCACC 0.991076 -127 ACCAAAAAGAATTTACCTTCTTTAGGTATT 1 19 1 ATTTACCTTC 0.978932 -110 TCACCTCCTTAATCTCCATCCAGGAATTTT 1 102 0 AATCTCCATC 0.966567 -27 TCACCCTTCACCTCCTTAATCTCCA 1 114 0 CTTCACCTCC 0.997741 -15 ********** Masking position 3 Map Score: 2.77301 Number of sites scoring better than the average of aligned sites = 236 Number in coding regions = 210 Number in noncoding regions = 26 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 3 CCTAAAGAAGGTAAATTCTTTTTGGTGATG 1 15 0 GTAAATTCTT 0.936497 -114 AAAGCAAGCTTTAAATACCTAAAGAAGGTA 1 32 0 TTAAATACCT 0.990112 -97 TTTTGGCAACTATGAAACCTCAAGCCAAAA 1 59 0 TATGAAACCT 0.901983 -70 GACATCCTAATAAAATTCCTGGATGGAGAT 1 91 1 TAAAATTCCT 0.990019 -38 ********** Masking position 5 Map Score: 0.441311 Number of sites scoring better than the average of aligned sites = 569 Number in coding regions = 510 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 4 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.89414e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0