AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i231_mjan_pyro_100.orf -o231_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ00617 135 M_jannaschii_chromosome #2 RPH00628 66 Pyrococcus_OT3 Motif number 1 TAATCTTATATTTATAATTTTTAGTTATGGT 1 17 0 TTTATAATTT 0.974685 -119 AGGAAGATGCCTTATCATAATATCATAATCT 1 42 0 CTTATCATAT 0.975985 -94 AGGCATCTTCCTTTTAATAGTAACTAAAAAT 1 61 1 CTTTTAATAT 0.972786 -75 ATATATAAATCTTTTAAATTTTTAGTTACTA 1 78 0 CTTTTAAATT 0.973023 -58 ATTTAAAAGATTTATATATGTCAATATATTT 1 90 1 TTTATATATT 0.873457 -46 ATTAACACCTTATAAAAATCTCTGTAAAT 1 117 0 CTTATAAAAT 0.987569 -19 GTAGGTGAAGTTTATAAAACTGGAATAAAAA 2 11 1 TTTATAAAAT 0.974606 -56 GCTCTCGCCACTTAACATTTTTATTCCAGTT 2 28 0 CTTAACATTT 0.909085 -39 ********* * Masking position 3 Map Score: 11.6403 Number of sites scoring better than the average of aligned sites = 592 Number in coding regions = 503 Number in noncoding regions = 89 Number of orfs with sites within 600 bp upstream = 97 Fraction of orfs with sites within 600 bp upstream = 0.0155798 Motif number 2 CTTATATTTATAATTTTTAGTTATGGTGAT 1 14 0 TAATTTTTAG 0.902514 -122 TATAAATATAAGATTATGATATTATGATAA 1 32 1 AGATTATGAT 0.889191 -104 TAAATCTTTTAAATTTTTAGTTACTATTAA 1 74 0 AAATTTTTAG 0.974034 -62 AAAATTTAAAAGATTTATATATGTCAATAT 1 87 1 AGATTTATAT 0.962522 -49 ATATTTACAGAGATTTTTATAAGGTGTTAA 1 115 1 AGATTTTTAT 0.992076 -21 CATTTTTATTCCAGTTTTATAAACTTCACC 2 14 0 CCAGTTTTAT 0.906583 -53 TCGCCACTTAACATTTTTATTCCAGTTTTA 2 25 0 ACATTTTTAT 0.988512 -42 ********** Masking position 3 Map Score: 8.04604 Number of sites scoring better than the average of aligned sites = 857 Number in coding regions = 602 Number in noncoding regions = 255 Number of orfs with sites within 600 bp upstream = 249 Fraction of orfs with sites within 600 bp upstream = 0.0399936 Motif number 3 ATATTTATAATTTTTAGTTATGGTGATATG 1 11 0 TTTTTAGTTA 0.989766 -125 ATATCATAATCTTATATTTATAATTTTTAG 1 24 0 CTTATATTTA 0.935633 -112 ATCTTTTAAATTTTTAGTTACTATTAAAAG 1 71 0 TTTTTAGTTA 0.989766 -65 CCACTTAACATTTTTATTCCAGTTTTATAA 2 22 0 TTTTTATTCC 0.955685 -45 ********** Masking position 5 Map Score: 2.19865 Number of sites scoring better than the average of aligned sites = 264 Number in coding regions = 190 Number in noncoding regions = 74 Number of orfs with sites within 600 bp upstream = 66 Fraction of orfs with sites within 600 bp upstream = 0.0106007 Motif number 4 AATTTTTAGTTATGGTGATATG 1 2 0 TATGTGATAT 0.984839 -134 AATATAAGATTATGATATTATGATAAGGCAT 1 36 1 TATGTATTAT 0.983653 -100 TTTTAAATTTTTAGTTACTATTAAAAGGAAG 1 67 0 TTAGTACTAT 0.90256 -69 AAGATTTATATATGTCAATATATTTACAGAG 1 96 1 TATGCAATAT 0.964421 -40 GAGATTTTTATAAGGTGTTAAT 1 124 1 TAAGTGTTAA 0.932292 -12 **** ****** Masking position 9 Map Score: 0.87119 Number of sites scoring better than the average of aligned sites = 173 Number in coding regions = 139 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0