AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i231_mjan_pyro_300.orf -o231_mjan_pyro_300.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RMJ00617 135 M_jannaschii_chromosome #2 RPH00628 66 Pyrococcus_OT3 Motif number 1 CATATCACCATAACTAAAAATTATAAATAT 1 10 1 AAACTAAAAA 0.851415 -126 ACTAAAAATTATAAATATAAGATTATGATAT 1 23 1 AAAATATAAG 0.975384 -113 AGATTATGATATTATGATAAGGCATCTTCCT 1 42 1 ATATGATAAG 0.973565 -94 ATTTTTAGTTACTATTAAAAGGAAGATGCCT 1 61 0 ATATTAAAAG 0.978678 -75 TAGTAACTAAAAATTTAAAAGATTTATATAT 1 78 1 AATTTAAAAG 0.978777 -58 AAATATATTGACATATATAAATCTTTTAAAT 1 90 0 AATATATAAA 0.913413 -46 ATTTACAGAGATTTTTATAAGGTGTTAAT 1 117 1 ATTTTATAAG 0.984218 -19 TTTTTATTCCAGTTTTATAAACTTCACCTAC 2 11 0 ATTTTATAAA 0.958935 -56 AACTGGAATAAAAATGTTAAGTGGCGAGAGC 2 28 1 AAATGTTAAG 0.893012 -39 * ********* Masking position 9 Map Score: 11.8347 Number of sites scoring better than the average of aligned sites = 1176 Number in coding regions = 944 Number in noncoding regions = 232 Number of orfs with sites within 600 bp upstream = 237 Fraction of orfs with sites within 600 bp upstream = 0.0380662 Motif number 2 CTTATATTTATAATTTTTAGTTATGGTGAT 1 14 0 TAATTTTTAG 0.906402 -122 TATAAATATAAGATTATGATATTATGATAA 1 32 1 AGATTATGAT 0.893546 -104 TAAATCTTTTAAATTTTTAGTTACTATTAA 1 74 0 AAATTTTTAG 0.975147 -62 AAAATTTAAAAGATTTATATATGTCAATAT 1 87 1 AGATTTATAT 0.964063 -49 ATATTTACAGAGATTTTTATAAGGTGTTAA 1 115 1 AGATTTTTAT 0.99242 -21 CATTTTTATTCCAGTTTTATAAACTTCACC 2 14 0 CCAGTTTTAT 0.910325 -53 TCGCCACTTAACATTTTTATTCCAGTTTTA 2 25 0 ACATTTTTAT 0.98901 -42 ********** Masking position 3 Map Score: 8.04604 Number of sites scoring better than the average of aligned sites = 857 Number in coding regions = 602 Number in noncoding regions = 255 Number of orfs with sites within 600 bp upstream = 249 Fraction of orfs with sites within 600 bp upstream = 0.0399936 Motif number 3 CATATCACCATAACTAAAAATT 1 2 1 ATATCACATA 0.985684 -134 ATGCCTTATCATAATATCATAATCTTATATT 1 36 0 ATAATACATA 0.984563 -100 CTTCCTTTTAATAGTAACTAAAAATTTAAAA 1 67 1 ATAGTACTAA 0.90622 -69 CTCTGTAAATATATTGACATATATAAATCTT 1 96 0 ATATTGCATA 0.966364 -40 ATTAACACCTTATAAAAATCTC 1 124 0 TTAACACTTA 0.935869 -12 ****** **** Masking position 3 Map Score: 0.87119 Number of sites scoring better than the average of aligned sites = 173 Number in coding regions = 139 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 41 Fraction of orfs with sites within 600 bp upstream = 0.00658529 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0