AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i271_mjan_pyro_100.orf -o271_mjan_pyro_100.ace -a/home/amcguire/genomes/ORF_mjan.txt -z/home/amcguire/genomes/mjan.fna -g0.37 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.37 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RPH00534 20 Pyrococcus_OT3 #2 RPH00533 119 Pyrococcus_OT3 Motif number 1 TTTCAATACCTCCTACTAAT 1 1 0 TCCTACTAAT 0.964661 -20 GAGTTAAACTTCCAACTACCTATATACAAC 2 24 1 TCCAACTACC 0.998027 -96 ACTACCTATATACAACTTCCCCTCCATTTT 2 38 1 TACAACTTCC 0.9746 -82 CCAGGTGGGATCCAGCAACTCAGGAGATGG 2 83 1 TCCAGCAACT 0.988171 -37 ATTCACTTTTTCCATCTCCTGAGTTGCTGG 2 94 0 TCCATCTCCT 0.990893 -26 ********** Masking position 1 Map Score: 6.00928 Number of sites scoring better than the average of aligned sites = 440 Number in coding regions = 423 Number in noncoding regions = 17 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 2 TTTCAATACCTCCTACTAAT 1 5 0 TACCTCCTAC 0.969824 -16 TTAACTCTGGTAACCCCTCA 2 1 0 TAACCCCTCA 0.988524 -119 CTATATACAACTTCCCCTCCATTTTAGTTT 2 43 1 CTTCCCCTCC 0.987197 -77 TCACTTTTTCCATCTCCTGAGTTGCTGGAT 2 92 0 CATCTCCTGA 0.987835 -28 GTATCTATTCACTTTTTCCAT 2 109 0 TATCTATTCA 0.881014 -11 ********** Masking position 8 Map Score: 1.39634 Number of sites scoring better than the average of aligned sites = 992 Number in coding regions = 885 Number in noncoding regions = 107 Number of orfs with sites within 600 bp upstream = 98 Fraction of orfs with sites within 600 bp upstream = 0.0157404 Motif number 3 AGTTAAACTTCCAACTACCTATATACAACT 2 25 1 CCAACTACCT 0.99528 -95 CTACCTATATACAACTTCCCCTCCATTTTA 2 39 1 ACAACTTCCC 0.991704 -81 CAGGTGGGATCCAGCAACTCAGGAGATGGA 2 84 1 CCAGCAACTC 0.990149 -36 ********** Masking position 3 Map Score: 0.337967 Number of sites scoring better than the average of aligned sites = 74 Number in coding regions = 59 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 4 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.37484e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0